Description :
From Genome Similarity Track
Location :
Scaffold_56:58809- 59822
Transcript NameFunction/comments
Physo_137639reverse transcriptase

Sequence
1013 bases(100 bases per row)
TAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAG
ACGCGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCACAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGG
CTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGGCTGCAAGGGAGCCTGCGCGAAAGGCGCAG
ACTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTT
CTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGGGTCCGCGT
TGTCGTCGACTGCATTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAACTTCTGACGAGCTTTGTCAGA
AGGCGCTGAGCCGTAGGCAAGCAAGAGCTTCGCGTCCACGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGC
ATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAA
CCCGGAAGTTATACTCTGCGAAGAAGGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCATATA
GACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTGGTTGCGCTCA
GCTGGCTTCAGCT