Description :
From Genome Similarity Track
Location :
scaffold_13:588038- 589322
Transcript NameFunction/comments
Plaha_PHALS_06218dual specificity
Plaha_PHALS_06219Phosphatidylinositol-4-phosphate 5-kinase

Sequence
1284 bases(100 bases per row)
ATTTGATGCAGCGTCCAGTAGTGTCTCGACTTGTCCGTCTGGCTCACACCGCTCGACCGAGCGTGCGGCCGAAACTGGAGTGGAATCCTCGTCATTGTCA
CTCAGCATCCCTTTTGTTTCGCGAAGGCACCGAAGGCGGTGTGTACCATTCATCTCAATCACTTCACTTTACAACCGTCTGCAGACTTCCGGTGTTGTGC
TTGTTGACTGTCGCAAAAGTTTTGAATTCTCGGCGGGCCACCTTCCGGATGCGTTGCACTTTCCGCACATGAGCTCAAGGGCTTATTTGCGAGCGCTGAG
CTGTGCTGGACAGAGTATTAAATCGGTAGATGATCTGCTGGAATTGAGTGAGAACACAAAATTGCGTGAAAAGCTTGAAATTCGAGACCTAATCGAAGTT
GTAATCATCGGTGGAAACCACACAAGTGCGTCATTTCTGTACAGGATGGATTGGGGTTATCGTTTTGCCAAGATGCTTGCGAATGAAGGTCGTGTTTTTT
CAGTTCGATTCCTGGCTCAAGGATTTCCCGCATTCGCAGAAAAATACAATTTCATGTTAGTGTCGTCACCATTGCGAATACCAACAGAAATAGGGACTAG
ACCACAGAAGGCGTTTACAGAGACAGCAATGTCGAGTCCGTCGTCGGCGATGCACTATCCAAATGAGATTGTAGACGGATTTCTCTATCTAGGCAACTTT
TGGCAAGCCAATTCGTTGAAGGTCATTAACGCCTTGCAAATATCTCATGTTGTAAATATGGGTGCGATAACCGAACAGCGAAACAAGTTCAAGCACGTGA
AGTATTTTGACGTTTTAATTAAGGATAATGTGGACGTGAATATTGCACAAGAGTTTGGTCCTACAATGAAGTTTATTCAAAAGGCGGCGGCGGAGAACGG
TCGGGTACTCATCCACTGCGTCCAAGGCGTTTCGCGTTCATCCACGATTTGCATTTGGTATGTTATGTTACAAACGAAGTGCACTCTATCGGCTGCGTAC
AGTCACGTACTTAAGTGCCGCCCCCTTATCTTTCCGAACCGAGGCTTTATGGCTCAACTCATCGCAAATGAGCGGTTACTATATGGTGATCAGAGCGTTA
TGGAGGATGAGTTAGAGCTGCTGCAGAACGGGCTGCTGCCGCCAATTGACCGCATCGGCTCAGCTTTGTGCCAAACATTTCTCTCTTAGTCGAAGTCACC
AAATACTCATTCCTAACAATATTATTGACAAACTTAATCTTTCGTAAAGACTTCCAAATCATCTCACTACGTGCAAGATGCGAC