Description :
From Genome Similarity Track
Location :
Scaffold_624:5880- 8814
Transcript NameFunction/comments
g15687.t1hypothetical protein
g15688.t1hypothetical protein

Sequence
2934 bases(100 bases per row)
CTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTT
ACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAG
AGCCTCGTCCCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAAACTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGC
CTCCAAGCGAGACTCAAGATTTGGTTGACCAAACCCGGGGCGTCTTTCCGCCCCTCACCCCACCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGC
TGGATCATCCAGCGAATTGTTGATCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGAGGGTTTCCTCCCCAACACGATACGTGAG
ACACGGAATGTCCTGATGGAGGACATTCCGGAAATGGTGACGGCGTACGAAGGCCACCTCCGCCGAAGGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCC
TGCAGCACTCGGATAAGTGCTGCGATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAATCTGGCGCGCAGGGTCTTCAGGTCGTCAGGTACACACATG
GACGTGTACCCGTTGATGTAATGGGTCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTATTTAACTTAAGTTTAGTATACT
TGTATCTGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAA
CTGATATTACTAATGAGAGGTTATGCCACTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGTTGTTACTTTCTACCAGTCA
TATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTA
GCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCAC
GCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCT
ACTGACATCGCCTCGACGGCGATGTCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGGTACCACTCGAGATGGCATGCTTCTCATGCCATCC
GAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATTTACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGCGAAGTCGAGGA
GGGGGAACTCGAAGGGGACAAGGATACCTTGTCCCTGGGCCACACTGACCCCAATGTGGGTCTACGTCGTCCACGCGAGGACGACTCGAACGCTTCGAGC
TCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGACGACTCCGCGGGATGGAGATGACTCCGCTCCATCCGCTGTTGTTG
CGGCCTCGCGCACTGAGCCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGTGCGACCGCGCCACCGAATCTGTACGCGCT
GTATTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGATTGCACTTTGATCCGATGACGGACCAAAGGCGCGATTACTACATCGGGCTCTTCCAT
GAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCATGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTTCA
ACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGATGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAA
GGCATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACAACTTTCTACCAATGAGAGTCATTC
AATAGATAGGGGTTCTGCCAGCCATCCAGTGGCATAACCTCTCATTAGTAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTT
GGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTCAGTATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACTCCTACGCTTCCTCCTAC
ACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTAT
GGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCC
CACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGC
AACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAA
ACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTGTCGTCGACCCG
TTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTG