Description :
From Genome Similarity Track
Location :
Scaffold_3050:588- 2675
Sequence
2087 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGTAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATC
CACGATCTAGGCCCCGGGTCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGACCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGCTCAGCAGAACACGGATCATCGGGGGACCCCATCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATTCGAACCAGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAG
GCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCTGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGG
ATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCGCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACA
AGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGGAAGAAG
ACGAAAACAAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGTCAAGGATCTCGAGC
TTGTGTATCGCCACCAGGCGTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAG
AGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGAT
ATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGG
TGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGG
ACCCTCCGGGGCATCCATGCTGAAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCCACGCGTGAT
CTGACACAATCCAGCCACGATCGAGCCAGATCCGACAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGC
CAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGAGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTAT
GAGAGCGCCCGGGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCAAC
CCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAG
CCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGC
GTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCA
GATTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGAGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGA