Description :
From Genome Similarity Track
Location :
Scaffold_1313:588- 1854
Transcript NameFunction/comments
Phyag_g10251hypothetical protein PHYSODRAFT_555553

Sequence
1266 bases(100 bases per row)
CAATAACGGTTTTTTCTGCGGGATTACGAATCACAAGACAGGGTATGTGAAATTGCCGAACAAGAAGGATGACCATTATTTCTATTGGTTCGTCGAGTCT
CGCAGTGATCCCTTGAAGGACCCATTGGTGCTCTGGCTCACGGGGGGTCCAGGATGCTCCAGTATGATGGCTCTATTAGCGGAAAACGGTCCATGTCATG
TGCAACCGGACCTGTCCACAAGGACGAATCCGTACTCATGGAATGGACAGGCCAATGTTATTTGGTTGGACCAACCGACCGGTGTCGGGTATTCTTACGG
CCCCCAAGTGGACTACGACTCGGGTGAACTCAATGTGGCTGAAAACATCTACTGGTTCCTGCAAGAGTTTCTGAAGGACCATTCACACTTGAAGGACAGG
GAGTTTTTCATTACAGGGGAGAGCTATGGTGGACACTATGTCCCTGCTGCGGCCAGTTATATTCTCAAGCAAAATATGTTAAGACACTTGCATCCGGACA
CAGTGCACATCAAGTTGGACGGCATTGCAGTGGGTAATGGACTTACGGACCCGGCAGTGCAGTACCAGCACAGTGTGGATATGACGTCCAACTCGTACAA
TGTGTCGTTGTTGGACGAACAGGCGATTGCGGACATGAGAAACGCACAACCAGTATGCCACGAGCTCATTTCGCAGTGTCAGAAGAACAGATCGACGTGC
TTTGATGCCATGGAGTTTTGCTTTGGAGCGTTGGAAGGGCCTTATTACCAGTCGGGACGCAACCCCTATGATATCAGGGAAGTTTGTGATGAGGAGAACG
TGATGAAATGTTTTCACTTTGAACATATCGACGAGTACTTAAACTTGCCTACTGTGCTGAAGGAACTTGGTGTGGATGTGGACAAGTCGAAACCGTGGAG
AGAATGTGATGCGACGGTCGGTGCGGGGTTTGTGTTCGATGAAATGGTTTCTTCTGCTGAAGATGtgaggctgctgttggaTGCGGGCGTGCGCGTGTTG
ATTTACGCTGGCGATGCTGATTTGATGTGCAATTGGGTGGGCAATCAGGCGTGGGTCATGGAGCTGGATTGGAGCGGTAAAATGCAGTTTAACAACGCGC
CCAATCGTCCGTTTGTTACTGCTGAAGCTTCTGATGCAGGACGTGTACGTACATTTGAGAATTTGGCGTTCATTCGTGTGTTCAACGCGGGTCACATGGT
GCCGATGGATCAACCTGCGGTGTCGTTTGAGATGATCAACAAGTTCTTCCAAAACGAGGATTTCTA