Description :
From Genome Similarity Track
Location :
Scaffold_77:58796- 71463
Transcript NameFunction/comments
g11556.t1OWZ18206.1 hypothetical protein PHMEG_0007745 [Phytophthora megakarya
g11557.t1hypothetical protein
g11558.t1hypothetical protein

Sequence
12667 bases(100 bases per row)
TCGCTGTGTACCCCCTGGGTACAAGCAGTGTGTCATCTTTATGGTGCACGACCGAGCCTCCGGACTATATGTGCCTGTCTACTATGTATTGAGCAATTCA
TTCTGGGACATGGTGCATTTCGTCGTGCAAAGCACTGACCAACAGCTTGAGCCGGCGGAAGTCGCGTGCGACTTCGAGAGCGCCATAATTGATGCCGTGC
AGACTCATTTCCCCAACGCAATCGTTATTGGGTGTCTGTTTCACCTGAAGCAGGCGTTCAGGTGTGCGATGAAGCAGTTCCTGATCCCGGAGGAAGAATG
CGGCATTGCGATGACCCGTGGGGTCCTCGACATGCTAATGGTGGTTGACCACAGCCTGATTGAGCGATGCATCAAGTGGGTTCAGCGCGAGATCCGACAG
CGCTGCGACGTCACTGGGACTGCGTACTCTAAAGCTAAATGGCGAGGATTTTGGGGTTATTTTCAACGGACATGGCTGGAGCAGTACGACGTGAGCGTGT
GGAACGTGGCCGGCCTGAACAACGATCTCGTAGCGCGCACGAACAACCCTCTAGAGAGGTTTAATCGCGAGCTCAACGACCGTTTTCCGAATCCTCGCCC
TAGTATGGCGACTTTCGTGGGTGTCATCAAGACACTTTCAGCTGAATACATTCAGCGATTGGCCGACGTTCCACGCGGGCGCGCGCGACGTCCTACACGC
GAACGTATTCAGCTGCCCGTACCCGTTGATCTACCGGACGACATCCTCGATGACTCGGACGACGACGCGCCTGCGGTTATCGAGCTGTCGTCGGACAGCT
CGTCGGATGAGAGGACGGAGAAGCCGAGCAAGAGCTTTAAATACACGTCGGCTTACCTTACTATTCTACTGCATCATGCTGGTTTGACCTACTGATCACT
GTTAGAGTAAGCTAGTCTGATCCAATACCAGCTCTGTACTGTATATGATCCCAACGAGGTTTTACCCCTCTATTTGTGTTTAGCTAAGAAACTATAGAGT
CTTGGTATCACTGGAGGCTTTGCCTTAAAATATAACAAATACGAAAGCGTCGCCGAACCCATCCGGTACCTTTGGCACCAAAAACGTGTTTTTTATACAG
CGATTCCTTAGGAGGAAAATGAGTTTTAGTGCATTAGAGATATGCGTGGAAGATAGGTTTTGAGACGATGTAAGGAAGTTGTGAAACCAACGGAGCAGTC
CGAACGAAGTAGTCGTAGTTAGTTTTCCACTTTCCTGTTCGAGCTTAATCCTCCACACCACACCTTTCTCGCCTCAACCACCTCAAAGGTCCTGCACTCG
GGTACCATGGTCCGACTCACCACGCGCTCCTATCTGCACTTGATGCCCGAAGTCGTCGAGCAAGAGCCGTCCAAGTATGCCAAGAGAGGGTATGTAATGG
GTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACATGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTA
TACTTAAACCTAGATAAATGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAAT
GAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCTTTTGCTAT
GAATGTGGACCACCCTATGGAGTGGTCAACCTGAATGTATGCCTTAATGCATGTTGCACTAAGAGTGACCACACCGGGGTGCTATTAGCGCCCCAAAATG
CCAGATTTGGCACTAGGATAGCATTGCACAGCGCCACCGGGGCGGCTAAAAGCTAAACAGATTTAGCTTTGAGGCCATCGGGGCCACATCTAGAGCTAAA
TTTGTCTCTGAAAATAGCACCAGCGGAGTGGTGAACAGTCTGCAAGATGTCCGAGAAACGAGGAGCGAACTACAGTGCTGCAGAGGATAAGGCTTTGTGT
GAGGCATGGCTGAATGCTAGCTGTGATCCTGTAACTGGGATCAATCAGACCGGAGACGACATGTATCACAAGGTGAGAAAGGTGTTTGAAGAAATTCTAG
GGCCTCCTACTACGAGAAACCCTGGCTCGCTGAAATCGCGCTTCCAGACAAGTTCGCGGTCTGTGTCGAAGTTTGTCGGTTGCTTCAAGCCGGTGGAACG
GCTGGATGTTAGTGGTAGATCTCCAACGGACATCATTCATCAAGCTGTGGAGCTGTACGAAGCTGAGAGCGGAAAATTCCGGTTTTTGCAGTGCTGGAGC
ATCTCGAAAGACTCGCCAAAGTGGGGCGCTTGGCGAGACGGAAACGCCAAGAAGACCTCTCTCAGGAAGCGGACGGCAGTCGAATGTTTGGCTGAACTAC
AATCTGTGGACGGTATCGGGAGTAGCATATCCGATGGTACATCAACAGCAGAAACAGAAGTAGCAGATAAGCGCCCCATCGGGCAGCAGCGTGCTAAAAT
AGAGCGCGCAAACCTAGCTCTCTACTCTAGACAAGTGCAAGCCACCGAAAGAATGGCGAAAACAGCCGATGCTCGCGTTCGTGTGGCTCAAGATCAAGTT
GATCAGAATCTTTTTAGCATGACAACAAGCACTAGCGACCCGGAGACGATGGAGTTCATCACGCTCAAACGACGACTTGAGTTAGCACGACTTCGTAAAG
AGGTTGCTGCTGTTGACACAGAGACTCCTGCAGCTGCAGGACATGGATTTCGGCTTGGTGATCAGCCGGATCCAGCCAGAGCAGAGCCCATCACTACCGC
GCCATTAACTCCAGCAGCCCAACCATCCCCCACAGTTACTGCAACGACAACACCCGATGTTGTATTATCGCTAATTATCTAGCACTGCTTAAGTTCAAAC
CACAAGGGTCGTATATTGCAAATTTTAACTAGTTTTCGAGACCGCGCATTGTCCAGAGATGACCTGTGAGATCGGATCTCAACCGAGCGTGCTGGTTAGT
GTTGTGAAGTTTGTGCGAGTTAGATATCAGCGTAGCAACTGTAGAAGATCGCGGTGGTCATTGTGGCCTAACAATATTGAATACTGGAATGCCACCAGGC
TGCGCCTCGGCATCGTAAAGATGCTCATGCACATTGCAATAGGGATCAGTGAGCTCGTCTTCTATGATCATGTTGTGGAGGATTATACAATCGTGCATCA
CTTGGGCCATTGCATCTGCCCGCCAAAGACGACAGGGAGTGTCAATTATGCGCCATCGCGCTTGTAACACACCGAAGCATCGTTCCACGTCCTTGCGGCA
AGCTTCCTGTCGCTTGACGAAGTGCTTTTGTTTTAATCCATGGGGTTTCTTAATAGGTTTGACAAACACAGGCCATTCAGGGTAGATTCCGTCTGCCAAC
AAGTACGGCGTGTCATACTGCTTTCCTACGAGTTTCACATTTAGTTTGCAGTCATTAAGAAAGCCAATGTGAAGAAGCACATCATACCAGATATCACGAA
CTCGACACGGGGAGCAGTACCCTGCAGAAAATATTGAAACAAAGGAGACTGGTCCAGAACGTTGATATCGTTTAGAGAACCTGGAGACCCGAAGTTGCAG
TGCCAAATTCGTAAGTTGTAGTCTGCGACGGCCTCAAGAATCTTAGTGGGCTTTTTCTCCTTCCCTTTGTGTTGTCCGGCCAGTGCAGTCGGACAATTTC
TCCATTGCCAGTGCGTGCAATCTACAGAGCCTATCATCCCAACGAAACCACGGCGAGCATTTTCCTGTAGAATTTCCTGTAATTCACTTGGTGTTGGTGA
CCGAAGATATGCACTGCCAAACCTCGCGATGATAGCACGATAGAAGCGTTTCAAGCATTTTAATGCCGTAGTTTCCGCTATTTCCAAGTTTTCATCATGC
GCGTCAGCAGCAGCCGCATGTGCAAGTTGTCGTAATGCAGCAGTAGTTTTAAGCAAACTCGAGATGCCTAGCTTACCGGTAGCGTCAGCCTTCTGTTCGA
AGTAGTCATCGGTCTCAACTACTGCTATCAGCACCTTCGTGAACAAACGTTGGGTCATTCGAAAGCGCTTTCGGAACGCTGATGAGTCGTAGACTGGTTT
TGGTCCAAAATACTGCTGCAGAAGACGTAAATGACGGTCGGCCGCTCGACGAGCTTTGTTTGCGGCTCTGCCTGGCCTCGAGCCACCCGGATACGACGAC
AAATCCAATCCTCTAGGTTTAGACAACACTAAATTCAGAACAAAAGCTCCCTCTTCATCCCCCTCATCAAGCAAGTCCGTCAACCAAGACGACGAAAATC
GATCAACCATAGCTTCAACGTAGTTAATAGCCGCACCACCGGTGTCAAATTGGCTTTTGGCTGATGCTATCAGCCAGGGGACATGTGGTTTCGCTGCTAA
ATATAGGATAGCAATAGCAACTACCGGTGTGGTCACTCTAAGGTAGGAGGTGAACCGACTGTGTAGCCCCGCTACACCGTCACACTTTATGTAATGCGGG
TACACGTTGGTGTACCCCGTTACACCTACGCATTTATCATTTGCACCCCAGGTCGTATCACACGTGCGCGCCTCGTGCTGCTGCTTGGTCTTGCTTGACC
TTGGCCCCTGCGAGCTGGCCCACGAGTTTCTTCGTTTTTTATGCTACACCTTTAGAGGTGGTATACATAATCTAGAAGCGTTTTGTAGCGATTTTCTTGC
GTCATTAACCCTTTCGCAAGGAGGAATTATAAGCTGATCTGTACTATACTATACAAAGGCAAGTTAAACGACTGTGAAAGGACGCAAAATTCGCTCTTTA
AGCTATTGGTATAGACGGGGTGTGTGTGCAAATCAAACACGATGCAGTTGGCAGGGACGACTTCCAATTCAAAAGGACGCAAAATTCGCCCTTTTGGATC
GCGTTTCGATAGGCTAATAAGTGAGCTTTAGATCTTCTTTCAGTTGATTGGTCAAAACAAAATAGCATTGCGTGCAGCCGCGGTTATATAACTGTCAAAC
TTACGAAGATATTCGGGTGCCGGCGTCGGATGATGATGCTCGCGATGTGAGCGGCCTCAATCGGGTTATCATCTAAAACATCAAGGTGTCGACCCGATAT
TTGACTTGATATTTGACTGAGTTAGTCTGCATGTGTCTATAAACAACGAATACCAGTAGATAATATCTACACAAAGACAGCCAGCGCTCTCGGGGGTGTT
GCAGTGTTCAAAGACGTGTGGGGAGCGTTGGTGAAAGCTGGATGGACATCAAAATGGCCTTCTACCAAGTGTTTAGACTCGCGCTACAAATACGTTCGGC
CTGGGGGTAAGCACGATGGCATAGAGGGAACTGACTACCACCTCGGTGAGCTGGACGGCTTACAGTACGTTGAGAACATGCGCGACAGTGAAGTTATAGC
AGAAGCAAAAGCTCAAGGCGGAGGCAAGAAAATCTGTTATCATGTGTTTGTGGAGAAGTGACCAGAAGTTTTTGGAGATGGATTGATCGTGTCCGACCAG
GTGATTGGTTGATGGGCACGGATGGATGGCTTTGGACCTGGGATGGGCGGCATCAACGGTCGGACGACCGGACGGTGAATGTGAAGACCATCATTTCGAT
CTTGGCAGATTTGGTCGCGGTACCACATGAGTTCAGATCAACCGATCGGATCAACATGGGTTCCGATCGACCGATCAGTTTGACATGGGTACAAATCAGC
CGATCAGATCAGCACGTACCACAAATACCGGCACATCGGAGGTCCAAGAATGTCAGCAATCATGAGATACGCAAGAGAGATGGGGGATAGGCACGTAGTT
CTTAATGGATAAACAGAGAGAGATTTTCCTTGTAGCACGCAAGTGGTCTTCCGAATTCCGGGGAAGGAAGTATATTGGCCTACCCGACGACCGGACAACC
ACCTGAAGTGACTCAAGCGAGAGCGCGGAAGCCCCTGGATAGCTTGGCCAGGTGCGCTCCCCTTCTCCCTCCAACTCATCAAGACCCCGCCATAGGAGGT
GGCAAGCATCGAAAAGGACCCCGTAAAGGACACACCCCGTGATCGATCACACACGATCGACACCCGAACCGACTGCTGCGTGAAGCATATCCGCGTGGCA
GCCAACCACCCCCCATACCTGAAGGGCCCTCAAGCCCCAGTTCTGCCCTGCTCACCACTGACTTCCCTCGCGTGATTACCGGAAGAGCGTAACCCGCCCA
AGCCGTCGGGTACACAAGGTGAGCTGTAAGGTCAAGATCCGCCGGATCAACGGAGTACCCCCTCGGACAGTCGGCAGTCCGGGCAACCGTTGGTGAGTTG
CGATCGCGTCAGCAATTTCGTGATCCCGCTCCACCACATGTTTGCTAGTCAAGGCGGCTAACGTTTGTTTATTGATGGTGTAGGTAAAGAAGTTGGTGGC
GACAGCAATGGTGGAGAGGTGGGTGCCCAAGTCGATGCCGCTGTTGGCAAGGCAGTTGTCACCGAAAATCAACGCCACCAATGTGATAGGCAAGACGACA
ACGATCAAGGAGCCTCCGGTGCGGCTATCACTCACATCTTAAGCGATAGTGATGTGGTTGTGTTCTAATTGAGAGAATTCGTTATATTATGAAGGTCATC
GAGATGGTTGTATGAAAACAGACGGCGTAATCGTCGGGGGGCCCACCGACCAAGTCGTCGTCGCTGGTGGTGGCACTCACAGTGGTGGCGCGCACGGTGG
TGGTGTACAAGTGCGTGGTGCTCGTGGGGGGGCGTACGGCACGGCGGGCCATGATGGCAACGGGTGCGTCGCGTGCATCGGAGATCCACGAGAATGACGA
AGCTAACTATGTGATTGTTGGTGGGGCAGGTGATGATACGCGCGGCCGTGGTGGCCGAGGACTAGCTGCTGTAACTATGATACCTCATCCGCATGGGAAG
GGAAGTGTGACCCCTACTGGAATTCCAGCAACTATCACAACGCCATCATGCACGCCACCTATCCTGCTGCAGGACGTCTACGTGGAGAAGTTGGTTGCGT
TCTCCCCCGACAAGGAGAGATGGATGAAAGCGAAGCCCTACCGCTCTGCTGGTACTGCCTATATCATTGGTCGGGTGTATCGCCAAGCAAAAAAAGGAAA
GTACGCTTCGCTATTTGAAATTCGTTGGTTGGGCAGCCAGTTCTAGAGCAGCGTGGAACAAGTCAGTGTGGGGGTTGTACAGCAAGGCATCAAGAACTAT
ACTACGCTAACACGAATGAAAAACCTTGATTGGCGGATACTGGTTCGACCCGATCCAGCTGATGATGTCGACTTCGAGGAAAATGATTCCGATCGCGAAG
AAGAAGAAGTGCTCGAGGCTTTCGACCCCACGGAGTTACTTCCAACTAGGTCGAAGCTATCCGAAATATGCGATTCATGCCGTCAGGAGAAGTTGATGCG
CCTTCATATCTGTACCAACACGACGATGGGTCGACCAAAACTTACTTGCGTCCTGAGTTCAAGCATTTGTTCGAGCATTCCGCCAGTTCAAGTTTCTTCG
CTTATATACCCCTCTATTTTTGGCGCCCAGTTCTACATGAGACGAACAAGTACGCTGTGGGGTACGACATACGCATGGCAACTCCTTTTACGCTAGACGA
ACTCATGATATTTCTTGGCATTCTCTTCTTCATGGCCGTGAACGATAAAGGTGAGTACGCGAATTACTGGGGGTTACAAGCCGAAGACTTAATTTTTGGT
GGAGCTACTACATCGTTAGACAGCATCATGACCCTCCATCGGTTCAAGCTGCTACGCCGGTGTCTGAGCTTCAATGCTACGCCTACCACACTCGCCCAAG
ATGGAGCAGCTCGTATCAGGCCACTCTTGAACTTGCTGAAGATTACTGGAGGTCAGTATATTCACGTAGGGCAAAATGTTGCGCTAGATGAAGCCAGCGT
CGCCTGCCGCTCTCGCCAAGGTCGTCACATGATCATGTACAATCCCATGAAACCAACAGGGAAGTACCATTTCAAGTTTTATATGGTGTGCTGTTCTACG
ACGTGGATCGCGTTAAACTACAAACTTCATTGCAAGCGAAGTGACGTGTTGAATCGACTGAATGGTGTAGTCGATCATTCGGAAGCACAAAGTATGAGTG
ATCAGCTGAAGAAATTGGAAAAAGCAAAAATCCGACAGCATGTGCTGGAGGTGACGAGGCCGCTGTTTGGTACGAATCGTATTGTCAACATGGATAATTA
CTACACGTCGGTTCAGCTGCTGCAGAGTCTTCGCCTGAAGGGTCTCTATGGACGAGGAACTGTCCGCTCAACTAGCAAACACTACCCTGTCCACAGTATT
TTGCCTGAAAACGACTGCGTTCGTGGAGACTATCGCCAGGCGGTCTCACATGACCACAGCATGCTGGCAGCGTCGTGGTGTGACGGTAATGTCGTAAACA
TGCTGTCTAATGCTGACGCGTCCAATATTACTACTGTAACCCGCATGATCAGCAGTGAAAAATTGTCATTTCCAGCGCCAGCGTGCGTCGCCCAATACAA
CGCCAACATGCAAGGTGTTGACAGGCTGGACGAAATTCGAGGACGATTTTCTATTGCGGATGGCCATTCATATAAACGTTGGCACAAAAAGCTGGCCCTT
GCTCTGATCGATCTGGCGAGAGCTAATGTGTATCTTGCACGGCGGTTGGTGAAGTCAGAACCGACGAATCGCGATCCACATAGAAGCTTTGTAATGGAGC
TAATAGGAGAACTTTTGAATGGGCAATGGAGGAACGCACCGAGCGACGGCCGCATGTTATACAATGGAGAAATGCTTGACGACGAAGCTGCAGAGCAGGT
TTCCACGCCTTCGTCTCAGCAGTGTGGAGGAAATGCTGCTGTCACTGCAATAACTGCGTGCGCTTCAGTGTCATCTAGGCAAATTCATGCCGAGAAAAGC
AGAAAGCGTCGCCGATGCATCGTGTGTAGATGGGAGAGACGATATCCGACAGAGGTGACAACATATTGCCTCCGACACGGTGTGTGTTTGTGCCGTGTCG
TGCACGATGTTCCCGCCAAGCCATGGATGTGTCCGTCGACGACATCAACCTGTTGGGATAAGTTCCATCAGTTCTATTATCCTAACGGGCTCTTTACGGA
TAAAGGAAACGTTCGGCGCCGATCCAACCTCGCCAAGTTGAAAGCCACTCATGAATCACGACATGGCGTCGTACGGCGACCAACTGGTGATAGCCAAACT
GCTTGCGCATCCGGTGGTGATTCTGTCATACACGAACGCGGTGGTGGTGCTGATCTAAGTCGCGACACCAGCAGACCTCAACGTCTTGCTGCATTCGGTC
TGGGTGGCAGCAACTCCGCTCACGAACTTGCTGCGTTTGCACTAGACAGTGGAATTGTGCCCCATCTCGGCGTCGAGGCAGGTCTTGGTGCCGCTTACGC
ACGCGACAGTGGCGACAGCACGACCCCAAACTGTGATGACACGGTTCTCGACGGCGACACCGCTCTTGGGTACAGCGAGGCGGATCTCGGCGGTAATGGT
GCTTGCGTGCGAACTTGGCGAGACTTTTTCCAACCTCAGCAATGAGGAGACTGACGGTGGTGGCGGTTCTCACAGACTTGGTGGAGGTGGTACTCATGGT
CCGTGAAGGTGACGAAGATAATACAGTGATTTTACACAGTGGTGCTGGCCAATGACACAGCTCGAGATTGGGAGCTGGGCATCCGTAAAGTGCGTCTGAA
TGGCGTGCTGTAGGCACCCTCGTTCATGACCTGGTGACCACTCGGGGTTTAATGCAGCTGGAGCTGAAGACCATGGAGTCATCGCACATGGAATAGTTAT
CGTGGTCTGATAAAACATGCAGGCTTGACAGCGTTGCAGATGATCTCAATAGAAGCAGAGCAAAGTGGGTTTAACATTTTTTATGATAGATGTAAATTTG
ATGACAAGCCGCCTTCCAGCTTACACGAACTTCTATCTGGTGCACTAACTTCCAGCACTTGCAATAGGGCTCTGAGCATGCGGAGCGATGCCTTGGACAA
AACTTCGAAGTTGCGATAATCACCCGTGCCGCTGGCATTGCACTAAGTTCTTGCGAAATAACCAACTTCGCGTGCTCTTCAAATAAAAATATGTTAGCAA
AGACAATGGTGGCTTCACAAAATGGAGGCTGACTTGATAGCAAAACATCGCGAGCATCCACTAGCCTGACCTCCACCTTAGCAAGATGGGGGTGGTTCTT
GAGGTGTTGTCGTATGCAGCTCTGTCCAAGTGTGACCAGATCGCTTCGGACCTCGAGGCCGATACACATTCTCACTTCCGTCATAAGCGCAACTTGCGCG
AGAATATTGCCCACGCCGGCTCCAACGTCGAGAAATATGTCCTTCTCTCCAAGAGGCCCAATTGCTTCAAGCATCTTCGAGACACCTGACGGTAACACTT
CCCCAGTATTTCCATAGGTACGACCAGCACGCTGGCGAACATCCCTCGCACTGATGCCTTCAAAAATGGAAGCTACTGCTTCTGCCGCTACGCTTGAGTT
GAGGCTAGATTTACGCTGGAAGAGGTCGTCAACACCCTCACCTCTCACTATAACATGGTCATCGTTGGCTCCCATGTCACGAACATATTCACGATTAGCT
TGTCACATACTTCTACTTTCAATCACACATCGCAACACTCACCTGTTACGTGTGAACCTCTTGAAAGCTGGAGAGTCAGGCATCATCCATGCTCCTCACA
CGCACTCTCTTGCGCCCCACAGTCATTGTCGCCTAATTGACGGCTTCTTCTTGCTACCGATGCAGCCGATGACACAGCTACATCACCCGAAGGCATATCA
GACAACACATCGCTACCTACTGAAGTCCCCCCGGTGGAGATAACGCCGACTACTCGCGCATTGGTCTCAACACACACGGTATCGCTACCCAGCGAGATCG
TGCCATACGAGGTGTTCACGCGGCCACCGATCCCAGCTTTGCTTGCGTCGCTGTCAAGTAAAATGACGCTCCCCGCCATCCCACCCGACGAACCCATGTC
GTCATACAATGCGATGCCACTGGCAACACCCGATGATCCACTGAAAGTTCTGTCGAGCATGCCGCCACCGCCCACGTCGTTATTAGTGCTATTACTAGCG
GCCATGCCGACAATCCCGCCACTAGCACAGCGATGCTCACCACTTAGCACGTTCACCATGCCATCAGTTAAAACGGACATCAATCCGCCACGTGCGGTCG
CGCTGGTCGTCGACTCGTCACGGGTATCCACACATCCTGCATCTACCGACGTCAGACTGCCGCTCACCACCATCATGTTGCCTGTGATGGGACTAGAGCT
ACCGCCATACACCAAGCTCGACACACCTGACTCCGTGCTGCCCGTATGACTGCCCACGATTCCACTCGCACCCAAGCCCGTGTTATCAGCACTGAACACC
GCGACATTGCCATTGGAAGCGCTTGCGTCGCCTCTGCAGTCGTGTAGAGTCACCGAACCATCACCGCTAATTCCAGCACGCACGGACACAGAACAACTGC
TGGACGTGGCATCTAACGAGGTAGCCAAACGAACCGGAGGTGCTAGCTGGGGTGAAACTTGGGGGAGCGGAGGTGGCGGTCCTGGCACGCGTATAAGCTG
TCTCGAAGTCAGGCCACTAAAAAAGCAATGCGGGAAGCCGCTGATCAACTTGCCGTATGTCCTCTTGAGGCTGGCTAGCCGAAGACGGAGCTGTCGCGGA
GTTCGCTTGGTCCTCATTTGACGGGCCACATAATCCCACGTGATACGCAGGCCTTCTCTCTCAAACTGACAGGCGATCTGCACCAACAGCTTGTCTTCCG
AGTCAGTGAAACTTGTACGCATTTGTGCTGATTTTGGTATAACAAAATGCGGAAAACCTGATGAATGCATATATCTAAACTTTTGTATGGTGAAATGACT
GGATGCTGTTTATGACAGACGTTGCTGATGACGCAGCCGCGTGCCTCTGGCAGATTACGGTCGCGAGCAATAAAATACAGATGAGGAAGCCGAAAATTAC
CCCCAGCTCTTTTCATTCACTGCTTTGATTGGTAGTAATAATAGAGAGCATAAAAAGTGGGAGAACGCTCAAAGGGCGCAAAATTCGCCCTTTGAGAAGG
TCATTCTTCACCGTGTTTTGATAACAGCGTTAAAAGGCGAAAAATGCGCCCTCGCACCGCGAAAGGGTTAAAATACGCACCCAATGTGATTATCTCTGGT
TTTTAATTGGCTCCCGTTATTCCGTACAATTGGCGGTCGTTGTGTTCTGTGTTGATTACAAATTAACCGAGCAACACAAGACCTCAGATGGCTTCCTTAG
ATTGAACGATATCCTGTGATTCATTCTTCTGTCAAGTTTGAAAATTTATATGTGACGTGGTAATTAGTCAGGGCCTCACGCAAAATAGTATAACTTTGAA
ATTAGTCAAGTGAAGACGACAAAATTGACACAGTCCGAGTGATACTAACTACGGTATTACCGAATAACCTTAGTCATCGCATACTACTTGTCATCGCATA
CATGGCTCTCCCAGCCAGGATACATCCATCTTCTAGCCCGAATACAGACCTCTGTACATGTACTAGCCAGTGGTTCACTTGCCAATTGCCATTTTGATAT
GGCTCCAGCAGAGAAGTGTCGTCCAAAACGACGACCACGACTGCCAGAGGCCAAAGGCGGCCTAATG