Description :
From Genome Similarity Track
Location :
Scaffold_559:5879- 7532
Transcript NameFunction/comments
Hyaar_Emoy2814323phosphatidylserine synthase

Sequence
1653 bases(100 bases per row)
CTTAAAATGCCCATTGCGACGCCAAAAAAATCAGCGGCGTGAAAGAGGCCCAGAAAAGTACGTCGAGGTATCCCCAACCAGTGACAAGTCTGCGTGAACG
TCGTGAGGCCGGCTGGGGTGGCTTATTTCGGAAGAAGAGCACCATCCAGACCGAAAACATGACTGCGAACGTCAGGATTGGGTACATCACTAAGTCTGGT
GGCGGTTGGGTAAACAACACGCCGTCAGCGGAGAACTTGATCCACACAAGAACCTCGAAGATAGCGATTGACAGAACCATCCACGAGTTCTGCCCTAATC
GCCAGCACTTTGAATTTGTGATAAACTCATAGTACTGTGCAATTCATTCATGTCGTCAAGGTAGTCAATAACCTGTTGGCAGCAAAAGATTAAGCGAAAG
AAAATAAATATGCAGCCGCACCTCAGAAGCTGCAGGAATCCCAATCATAAACATGAGAAAGAGGCGGTACGAGTTGAAGCTGCTCTCTTTCGGAATGCCC
AACGTTGTCAGCATAAAGAACGCATTGAGCTCTGTGACTAGACACATCATCATCGCAAAGACAATCTCCGCGAAGCGCTTGAAACTTGAAAACACTTCCC
AGTGATATTGTTCCCATCGAAACGGCGTGAACTGGTTCAGTGCCAGGCGAAAATAGCCCAGCTTCTTGCCTCGGCGGCCAGACCAATCGTACTCCTTCGA
TTCCAGCAGCCACAACGTAACACGGCCAAGACACATGCCCAGCAAATTCGCACCAAGCATATCCAGCAACAGCGAGTCCCACCTAAGTCACCCAATCATC
AACCACCAGCAACCACAACAAATAGCAAAAAACAGCAACCAACGCATCAATCAGTTTCCTCTCACCACCATAAGAAACACACACAAAAACGTCCAATCAT
CGTCACACACCAGCATTCTTTAAAGTCTGGAATCACAAACTGCAGCGCCAGCTCCAGCAGCTCGAACGCAATACTAAGTACCCAACAAAAGCGCCAGTCC
CGAAACATGCACATTTTGCCCCACCAGCCCGTCATATGGGCAAAGAACCAAATACTCGACACCCCTCGTTTTAAAGCCTGCAAACAAAGAAGAAGAAGAA
AAAAATATCCACATCCAAAAGTCCATTAACCCCCCCCCTCAAATAAGCAGGTTGCCTCATTTTTTTCAACCACAACAAAACCCCTGCATCAAACCTCGTT
ACCACCTACCTCATAGTTCATTTCACACTGCAGAACGGTAGTTTCTCTTGTAGTTCCCTGCTTATGTCCGATCCTTTGGAACCGACTCCCCACTTCAGGA
AACACCAACTGCATCGCGTGCACTGCACTCTGTCGGTTCTGCACCAGCATCGCGGCCAAGAAGAGCAAATACACAACGGAGCAGCCGTGCACGACTCTCC
AGACCCCTGGATGCGGCCGCGTCAACAGTCCGTCTTTCGTCTGCAAGAAGCAGTAGACGAGGAAGACGAGCACGGCCGCGTACAGCGCGTTGCGTCCGTT
CTGAGCCACGTCTGGGGAGTCGTGTGTGAAGGAATAGTACGATATTGTAGCTACGACGAGGAAGAGCACGAAGATCTGACGCGGTTGTTCGGGGAAGAGC
AGGAGGCCGTCGAGTGGACGACCGTGCGAGGCACGGAAGGTGTTGTACGATGA