Description :
From Genome Similarity Track
Location :
Scaffold_20:58782- 62918
Sequence
4136 bases(100 bases per row)
CGCAGGTAATCGTACAGGAGGCCACCGCACGACAGATTGGACGCTGGTTCCCATGTCGGCTCGTCATAGCCGACCCACTTCACCTTGAACTCTCGGACGG
CCCGGTGAGTGCTCGTTGACAACGGTGTCCGGTCATCGAGGATAGCCTCGACTTCATACTCACCGTCCAGGTGGTCCGGCTCAAAACTGTCTTCAGGCAG
TAGTTCCTCGTCGAAGTCAAGACGAGTGTCTTCGGTGACCCCACGAGCCAAACGAACCCTCGGTCGGCCTTCGAATTCGTCCACTGACTTGAGTCGTGAA
ACATGCACCACCGGGTAGAACCGGTATCCACTTCGGTCGGGTAGGTCCAGCTCATACGCAAACTCTTCGACCTTCTTCTTCACGCGGAACGGTCCGTGCC
ACCGATGGGCTCAGTCCTGGTCGAACCCGCTCCATGTACAGCCACACTCTGCTCCCAGGCTGCAAAGCAAGCCTCGTTCTCGTCACTGTAGCTCCACCAT
GGTCAGGGGAACTCGATGCTCGGTCGACCGAGGTTCTATTCTCGCCGACGCCTGCCGTAGCTCCTTCTCCTTCCTTCCAAGTGATGCATTGTGCTCTTCA
GCTCTCCGAGCCTTTTCCGCGGCTTGGTACTCCTTGGTCATCCTCAGGGCGATTTCCTGCTGTCGGTTGACCTCTCGGCGCCATGCTAGCGCGTCAGTTT
GGCTACCGAAACCTCGTTTGAGCGACGCGGACATTGCCTTGAGCGTCGACTGTGCATCCCACCCATGAACGAGGTAAAACGGAGTTTCCTTCCTCGTCGT
ATCACGGGAGTTATTGATGGCGAAGATCAGTCTTTCGGCGATCTCGTCCCAATCCTGCTGCAATGGGTCTTCAGCGTATACGCGGACTGACTGCATGATC
GTCTTCACCGATCTCTCCTGCTGACCGTTGGCCTGCGGTCGGTAGCTCAGGGTCGCTCTCGACCGAGACTGCATCATTGCTGCGAAGGCTCATAAATCGA
GGATCTCGGTCATGACGGATCAAGGACGGTGCCCCAAAACGTTGGTAGACACACTCCTCGAAAGCTTGCGCAACGCGTAAGGCGGTAGTGTCAGACATGG
CTTTGCCCATCACGAATCCCGTGAACGAGCATTGGAACAGCAGGAGAGCCGTGTTGCCACGGCGACTCTTCGGTAGCGGTATCACGAAATCCATAGAGAC
TAGTTGGAAGGGCCTCTCGGCTAGGATGTTCCCTGGCGAGTACCCGCGGAACTGGGGTCGGCTCTTACTTGAACTGCAGTCAGGGCACGACTTAACGTGT
TTCTCCACATCGGCATACTGCCCGATCCAGTAATAGTCTCTCGCTGCTCGATGTAGCGTACGAGTAATATCTTGGTGACCGCCTTCGAGTGAGTCATGAC
AGCTTTGCAGGACCTCTTGGATCATCGTTGTGGCTCATCTTCAACTCGGCTTGCTCGTCGTCAGTTGAACGACGGCTCGTTCTAGTGTAATATAGCACAT
CGTCCTCGCTCAACACACATTGGTCCGCCATTTTCCATGCATCTCGTGCTGCTCTGTATCCAATCTTTGCATCGTCTCCTCGTAGCACTGCCTTCCGATT
CGACCACCGTAACTCTTCATCTTGAGCGGTGGCGATTCTCCTTCGGCGTTCTCCTTGTACTACCAGCGGGTCAATGTCTTCTGCGTACGGTGGGGCTGGT
GACGTCTCGGCACGCAGCGGTGAAGCTTCTGCTTCATTCTGAGACTCGTTCGGCACACCATTGGCTTCTACTCGGTGAGATGCATCTCCCTGATCGGTGA
CCGAGACTTCATCTGCAAACCGGGCGTGTTTCGCCTTTGCTCTCGCGTGCCGTCTGGTCATCACAGCCACATGTCCGGGTTCAGTCTCGTTCTGCCGTCT
GTGGTCGGTTTCTCTTCGCACAAAAGCGAAAAAATTCTTGCTACGAGGTTTGGCAGAAGCTACCACAGCCCATACTGTGTTGGCCGAGGGTATGTCCTCG
ACGACGCATCCGTCAGCAACCTCGTAGATGACTTCAGCGATACGGTTCAGCTTCATCAGCTCTAATACTCGGTCGTCCGACGATACCACCGTAGACTTCT
TGCACTCGAGAGTCTCGTTTTCCAGAGAGTCGGCCGCAGCGTTAAACTCTCTCACCACATGCAGGTACTTCACCGACCGCAGTTTGGCCGTGATTTCTTG
TGGTGAATGAGTTGTTGCAGCAATGACCCCTTCCGGCAGGCTACCACCCCTAGGGCTTGCTGGATCGCGAGCCTCGAATCGCCAACGACGACTAGATCGT
CGGCTCCATGCTGTAATGCAGCAGAGACGCCGTTGTTCATTCCGGTGTACTCAGCGAGGTTGACCGTGGTGTTCTCGAGGTAAGCGCTCGCGGCAAGCAC
TACAGTCGACTCTGGTAGCTTCCATAGTATCCACGAGCAACTGCCATATCCACCATTCTTCTTGGTCTTCGCAGACCCGTCAAACGACATAACGAAGCCT
CGATAGGACTGCGGTAGGCGTGCGTAGAGCAGACGCGGGTCCAAACGAGCAGTCGGTGGCCCTCGCGTCCGGGTGTTATCAACGCCAGTGACTTATCCAA
ATCAACGAAATTCGTCAGGCCGGCTTGGAGTAGCTGGGCGAACGAACAGTCGGTTTCTTTGACTCGTTCGACCAATAGGTGCCACGGTGACAGCAAGACG
GCGAACTGGGGAGCCCGACCGAACAATGTGGACCCAGTCGAGTGTCGAAAACCGAGTGCAGACCCGGACACGCTGTCCAACGAGTTGAGTATAACACACC
TTCAGTATCAGCAGAAGCGCGAGGACCTCTTTCTCGGCCGGGTGATAATTCATCTCAGCATCCTTCAAAACACGTCCGCAGAAGCGAACGGGGTGTAGTT
TGCCCTCGTGCTCTTGCATCAACGTGGAACTTAGAGCCCACTCGTTGGCAAACAGCATAACATGTACGTCCTTCTTCCGGTCAAAATGTCGTAGTATCGG
CGCTGCCGAGATCCTCTGTCGGAGCATCGCAAAGCTGTGCTTGGCCGCGGTGAGGTCACCCCCGGCTGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTG
CTCCATAGACCGCGACGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGTACTGCATTCCTTTCCTCTTTGACGGGAACGGAAGCTCGGT
CACCCCAGCCAGCTTCTTAGTGTCCGGTCGGATACCTTTTGCCGAGACTTTGTGGGACAGGAAGTCTACTTTGGACTGCACGAAGATGCTCTTCGTGATG
CTGATACTAATACGGTACTCTTCGAACCGTGCCAGCAATCGGTCTAGCGTCGCCAAGCACGACTCGAAAGTCTCGGCACCGAAACAGATATCATCCACGA
AGGACCGGCGTCTGAATACTTGTGTCAACGAGGATTCATCGGGCTCCCCGTTGGCGAACATGTCGGCGATAGGGCTGTTGACTAGTTCGGCTACAGCTCC
CTTACCAAGCGAGTTATCTCGGTCGGCCTCGAACTTGGTCCGGAATGGTTTTGGCGCGCCAGTCGAAGCCTCGTTCACCCCAGCATGAGCTTCCTTGTCA
TGTTCTTCAGCTAGACGTATGCGCTCCGAGAATTTAAACCATCCTCCCTTCGGTTGGACGAAGCCCCAAAGCGCGTTGTCAATCATGCGTTGATAGATCA
TCGGTGCGTTCTTCAGGCCGAAAGGCATACGCAACCACTCGAAGTGCCCTAGTGCGCAGACGAAAGCAGAGATCTTCCGAGCTCGTTCGGTCATCATAAT
GGCCCAGAAGCCGCTAGCGGCGTCGAGCGAGCAAAACCACAAGTACGCCTCCATGTCCTGTAGCGCGTACTCCATAATCTCGGTGATCGCATTAACGAGC
TTGTAGTCGATACACAGGCGGATATCCACCCCATTCTAATTCAGGACGATGACGATTGGCGACGCCCATGGGCTGTCCGAGAAGGAGATAAGCCCGGCCT
TCAGCAGACCCTTCAGCAATTCGTACAGCTTACCGAGGAAGCGAAGCGGGGTCCGCCGAGCCTTCTGTTTGATCGGCACGTGCCCCTGTACATTGATGTC
ACATACAACACCATAGGCTGGAGGCGGCAGAGCGTT