Description :
From Genome Similarity Track
Location :
contig_1:587815- 590411
Transcript NameFunction/comments
g188.t1hypothetical protein

Sequence
2596 bases(100 bases per row)
CTGCATACGCGATTCGACAGCTCGACGCGTAGGCTTTCTCTTGCGGTTCGAGCGGCGTGCACTTCCAATACTGTCGCGCATCACACCACTAGCGACAGGA
GAAACTTCGACTGACGAGGGCGTCGGAGTCGGTTGAGTTGGAAGGTCCGTCAATTCAGGAATGAGGTCTTCTTCATCCAGCGCCACCGTATCAGCGCTAC
TTTCTGTAGAAGCCGGGCTAGACATGCCCTCCTCCAGCCGCATATCACCATCACTATCCGGATCTAAATCATCTTCTGCAACATCTGTCAGAAATGTGGC
GCTGGCAATATCTCCTACGAGTACAGAGTCCGTGCCATCCACATGAATACTGCCGTCTGTTTCTGGATCCGAGCTCTCTGCGCGCGAGGAATCTTCACGG
CTATCCGCGTGAGTGCTTGTCAAAGCACGGTCTGCAGCTGTGCGTCTGCGACGTGGCCGAACAAACTGGCGACGGCGACTATCAGCGCCAGGGCATGGTA
TGCCTGCATGAATGCAGGCAGCCACAATGTGGCAGCACATGCCGTGCATTCGACTGTAGACACACGTACACGCCCTGCTGCGAGTGTCGACTACCCGTCC
CCCTTCTGGCATCCCTTCAGTTTGCATCCGACGTGCATTCATGGATTTGATGGAGCGCATCAGCTCCTTTCGCTCATCGGCTGTCAACGCACCGGCTCTT
TGATTGACGACGTAAAGATCCGCGGATAAGTCGCCGACCGGAGGGATGCGCCGTACGGATAGCCAGCCACGACTGTTCATAAATCGATAAAGCTTGAGCG
ATCGGTCGGAAGCGGCAGCGACCGTGTCAAATGGCACGTCTCGGTTCTGAAAAGCGAGCCGGGCACCGTTGAGATTGCCGACCAACTCTCGGGGTGTAGC
CAGACCTTCCGCACAGTGCAACTTTAGTGTTCGATGATATTGCTTCAAAGGGTTATTTGAAGCGGCATATCCACCAGGTGTGTAGAACGCCTGCCAGCGG
GAAAACCGGGTCGAGTTTACCCAAAACCTTTCACATGATCTGTGAGTTTACGTACTCAAGAACCGAGACGAAACCTGTCCCATCGCTCCAAAACGCAGGC
CTTTACAGCAGGAAATGCATCTTGAGTCGCATAATGCATGTCGTACAAATCCGCAAACACAACTCGTGTATCTTCCGTGCTCGCACGGAATGTGCGAGCA
TGTTTCCACACATTCTGTGTCACGTGAAACCAGCACATCAAAATGGTTGTACCTGGAAGCTCGGCCGAACAGGCGTTGAACTGCGCATTGCAAGCATCTG
ACATCATGAACTGCGGCGAAATGGCATCCAAACACACGCGCTTCATGGCTGATGCACCATCCGACGTCAATTGCGCGCTCTTGAGATGTGCAAAAGTAAG
CGAGAAAAAAGAACTGGCCGCACCGATCTGAGTATCCAAAGGCGAACACGTTGTAGCCGTTGATCACCATACTGTGGGTGCTGTCAACGTGAAATATCGT
AGTGCAATCCGACCGATTCTGCACTGCAATATAGTCACGGACGAGACGTAGACGCGTCATGCCAACACGATAAGGAGAATCCTCAGATCCGTCTCCGAGA
TGTGAGGCGCTGCTCGCGGTACCGGGCAGATCACTTTGTTGCGCGTCGCACAGTATCATCATGTCGCGCTCAGGCAGCGACTGTAGATCCAGCTGATCGT
ACAGATTTCCATCGCAAAGCTGAATCATCGACGCCATGGAATCTCGTGGGTTATCCCACCTCCAGTTTTTGACAAAATCAGTCACTTGAGTGTCTTTCGG
AGCAGGACCTGTGATCACACCTGCCTCGACCATGGCGCTGAGAGTAGTAAACAACTTGGTGGCTGTTGTTTTGACTCAACTACTTAGCTTCTCGTTAATA
AACGTCTTCATTGCAGGGGAAATCTTGCGCTCTTTGGAGTTGGCGGATAGGTTCTGTGCATGACATGCTCGCCTTGCTGAAACACCTCACAGGTGCTAGA
GGACAGACAGATCTTGAACTTGTCCGACACGGACATGATGCCGTCTCTGTCGATGTAGCGTCGTCGTCAGGGGCAGTGAGTCTGGCACGACACCGCTGAG
ACCGGCACAGTACCATTTGAGACCGCATTTGATGCATGCAGCAAGCTAGATCGAAGTCCTTATCAAATTTATGATCCACAGAACATCCCCACTGGATTAC
TCTTGTCGATACAGTGAGTTGGCAGTGAGTCCCGAAAGGACTGTAGTGCCCCGACACTGTTGATCTCCATATCTTGGTCCATGTTGGTCGGCGACGCTTG
GCTGGGCCTCCTCGCCATCCGATTCAAACGTCTGTAGCTGCAGAATTCCATCAGAAATGGATAGCAGCTCGCTATCGCGCTCGGACATTGTTAGTGTTCA
CTTTTCGGCAATGCACGCAGGAGGCGAACAGAGAAGCATATATTGAGCTAAACAGCTACAAAAGTCACTTCAACATCTTGAAGTGCTTTTTGGTGTTTGT
CTATTTTTCTGGTGGCGCCTTTCTGGCAATTTGGTGGTGCGTCCTTTTTTTTCGAGCACCACCAAGCGGATGGATCCCGCTTGGTGGTGCTGCACC