Description :
From Genome Similarity Track
Location :
Scaffold_969:5878- 7681
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_969-snap-gene-0.8Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1803 bases(100 bases per row)
TTCAAGATCTATGGTTTGTGTTGGGCAGGTGAAAGCAAATGGGACGACGGCGTCGCGTGCGGCGTGACGAAGACGATGACGGTGATGGCGATGACGAAGG
CGCTTTCCCTCTCCAGTATTTGTTGCCTCTCCACCCGACACTCGCGGTGGAAGTTGAAGAACCGCTCGACACTGTCTCGGTTTGCCCTCCAAGAGAACAA
GACGACCACCGCGATCCAATCGATGAGTTGAATTTGTATCGGCAAGCCGTGCCACTACTGCATCCGCAGTCGACCTCGGCTGCTCGCACGATCGGGAAGA
TGCTGGGCAACAACAAGATCGCCACGCGCATTCTGCAGCGAAACCAGGCTGTCAGCAGCCTGGTCAGTACACCGACCGCAGCACCGAACTCCATGCGCCG
TCTGCAGTTCCACAAGACGTGTGAGGACTTGTTCTTTGGGTTTGATCCCATCACCACGCGCACCAAGCGACTGCCGTTGCACCGGATGCGGCTTCTACTG
CACCATTATGGCTTAGAGGTTGACGACGTGGCGTACCGCCAGTGGGAGCAGAGTCTCCCGGCTGATGTCACTGACGTTTCGCTGACTGCATTCATCCACG
CGTGCACGCAGTGGTTCCCCGAGCCATTTCTTCTCGGCCACTACGCAGCATGGAGGCAGCAACAGCGAGAGCAAGATGCAGCGGCCGCTGCTGTCGGATT
GGGCAAGTGTCAGTCGGCGCCTCAGTTACTCCACCCGTTTGACGCGCTCGCCCGACGCCACGACGACGCGGTGGCGTTCTCGTACGAGAACTGTGCCCAA
GGCCCACCGGTGAGTACGATCGAGAATCGCGCCACCATTCCCAGTGGAGGCACCAAGGTAGTTAACCGATTCTCCTTTCGTAGCGTCCATACAAGACTCA
AGATGAAACGCGTGCGAACAAGAGCCACGCGCTACTCCGAGCGACCCAGCAGCTGCGCCGACAGACCAAGATCCTCACGCGGCTCAACGCAAACCTCGCG
ACTGCGAGCCCGCCGTCGCCGTCCGCCAACGGGGCAGGGACAACCCATGACCGTCTCCATGAGGAGAAACTCGCTCGCCACATTCTCCAGCGCTGTGGCA
CGCAGGCGCTTGCCCCGTCCAATCGCCGCAGGTCATCGATGGCGACCAGCTTACTCTCCTCTGCTACCGACCAGGCTGTAGATCTCCAGCAAAACCAGTT
CGCCGCGAAAAAGCTGAGTCGTCAGCAACACACCGAGACTGCCCGGGCCTTCTCTGCGAGTATCGCAATGATTTCACGCCATGTCCACAACGAAGAACTG
CGTGACCTCCGCGAGATTGAGTTCGAGAAACAACTCGCGATCGTCAACGACCGCAAGCAATTGCGGCGTCTGCAGCACGCGCACTGCCAGGCACTCGCCC
ACGAGAAGAGCCACCAGCAAATGCGAGATGTTGTGGCCATGAAGACGCTGGCCCACGAAGAAGCCGAGCTCGCGCGGCAGTACTCGGAGAGCCGTGAACA
CCAACTGCGCGCCCAGAAGGCGCCGTTCTCGCTGTCGTCCTCGACAAGCACACTGTTCCAGGCGCCGCCCGAGATTCTCGCGGCCAAGGCCACGGTGAAG
ACCATGTCCCAACGAAAGCGGCTCCAGCAAATGGAACAGGAACACCTCGACCACATGCGCAGCATCCAGCTGATCGACTACGCGTATGACAAGAAGCGAG
CAGTGGACGACGCCAACGTTGCCAAGGCCGACGCGACGCTCGTCGATTTACGAGTTGAAAACCTTCCAGCCGCCCAAGAAGCGGCGCTGGCGACCCAGGA
ACT