Description :
From Genome Similarity Track
Location :
Scaffold_26:58772- 61548
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009538Similar to mvaA: 3-hydroxy-3-methylglutaryl-coenzyme A reductase (Pseudomonas mevalonii)

Sequence
2776 bases(100 bases per row)
TTTGATCCGCTGCAACCAAGTACGCATGAAAGCGACGCATGGTCCACGTCGTTGGCAACGAAAGCTGTCCCCGCGAATTCGTCCCAGCCGTCTGTATGGT
CGGGCTTTTACAACAAAACGCTCCGTGAACGCTTTGATGTGCTGTCGCTGATGTATCCGCGACTCGGTCGCATCAAGCAGAACGAACCTCAAGACGTACC
TATTGAGTCGGCGGATCCGGTTGGCAAACTGGGCGAATTGCCCATGCGCACAGCGAATCTCATGATCGAAAACTGCATCGGCGTGATCGGGATTCCATTG
GGGTAAGCTGCATGGACATGCTTTGCATTCTATTGTGTATTGACATTGTTCACATCGTGGCTAACACTTGAATCCTGTCTGTAGACTGGGTCTGAACTTT
GTAATCGACGGAAAGAGCCTGTCTGTCCCGATGGCCGTCGAAGAACCTTCGGTCGTGGCTGCAGCGTCCAGTGCTGCCAAGCTTGTCGCCTCGTTCGGCG
GTGGCTTCCACACGGCGACTTCAGGCAACATTATGACGTCGCAGATTCAGCTGGTCGACACTCCGGACATTGAAACGGCCGTGAAGGCCATCGCTGACAA
TCGTGAGCGCTTGCTCGCGTTTGCAAACACGTCGCTATGTCCCAACATGAAGCAACGCGGTGGTGGTGCGTTGGACATCTACTGCCGCGTCGTGAGTGAA
GCCTCGCGGTCAAAGTTCTCCCACAGAGACCACAACCTCCACTGGTACGTCCCGTGTGACGACGAAGTCGTGATCTCAGCGTCGGAGTCGCGCGCCCAGT
ATCTCGTTGTTCACATCGACGTGGACGTCTGTGAAGCCATGGGAGCCAACATTGTCAACACTGTTGCCGAGGGGCTGTCGGATGAAGTGTCCAAGCTCAC
GAAAAGCCGCTGTGGTCTCCGCATTCTCACGAATCTGTGCATGCAGCGTCGCGCGCGATCAACGTTTGAGATCCCTGTGAAGAAGCTTGGCTGGAAGGGC
GTCGACGGCGAGGATGTGGCGCAGCGGATCGTGGAAGCGTACAACTTTGCCGCCATCGACCCTTACCGTGCGGTCACCAACAACAAGGGCATAATGAACG
GAGTGGACTCCGTGGCTCTTGCGACGGGTCAAGATTGGCGCGCGATCGAAGCAGCCGCGCACTGCTACGCGAGTCGCTACGGCCAGTACACGTCGTTATC
GCACTACGAGATCACGTCTAATACCGACGGCGTACGCGTGCTTCGTGGCAAACTGGAATTCCCTATCGCCGTTGGTTCGAAAGGTGGCGCACTGCAAACA
CATCCAGGATACACGGCGACCCACGCCATTCTACAGCAGCCTAGCGCCCGCGCACTGAGCAGCATCATCCTCAGTGTCGGGCTCGCGCAGAACTTTGCGG
CGATCCGTGCGATCGCGATCACGGGTATTCAAAAGGGCCACATGGCACTGCATGCTAGGAACATTGCCGTTGCTGCTGGAGCGCCAAGTGAACTGGTGTC
AGAGCTCTGCACGTACATGCTGGGCCGCAAGAGCATCAACATCGGGACGGCCAAGGAGTATCTGCATGCGCACGCCGTGTTCTCGGAGATCCAAAGCAAC
TCGCCTCCGATTTCTCCGGTGCCTGTGACGCTGCCGTCCATGTTTTACGTGGAGATCCCCGTGCCGCATCTCGAAGGCACGATCAGCTTGAACATCGCGT
TCGAGTCCATCAACAAGCACCCACAGTACATTGCAATCATGGCGCCACCGAAAGCCAACGGTGATGCTACGAGCAGCGCGACATTGACGAGCATTCAGCG
GCAACTTCTGGGGGACAAAGGGTACAATCAGCTCGAGAAGATGTTCATGTTTTTGGCGTCCATGCGCTCGATTCTCATCTCGGACGATGCTGGTGACGAT
CGCGAAGAGATGAAGTCTCGTGCGAACCTGGCGCTGCAGAACAAACTGCAATTGCTCTCGATCTTGCTCAACATCCTCGCATACCGACTTATGGAGGTGC
GCTCGCAGAGCGTTAGCGAGTTCATGCGCAAGATCCTGGAGTGCGGCGACATCCGCACGATGGACGTGAAGCGCTGTCGCAGCATCCTGGCCGACGTCCC
GTCTTCCGACGAAGTGCTGAGCACGGGTCTCCCGTTGTTCTTGGCGCTCTGGCAAGTGTTCCATTACCACATTGAGCAAGAAGTGCCACACACACTTCTT
CAGAAGCGATTGATGCAGGAGCAGTGGCGGCTTCTAAACTCGATCGTCGAAAGCTACGAGCTGGGGCTGGCAAACGAGCCTAGCAGTAGCGGTCTTCTCA
CGAATGACGCTGGCTGTGACCTGAGTGAGGGCTTCTTAGCGTACATGTCCGTGCAGGCCAAGCGATGGCAAGCGACATTGCTGCTCCTGATCGATTCTCT
TGCACTTGCGTCCGAAGTGCTCACACCCGAGCGACTCGATTTCCTCAACCGTATCGGCGAGTACATGGAATGGGAAGGCACCATCGCGCACGATCTCGCG
AGGTACACGCGTGCGGTCACGGAGCGCGTCCCAAATGCGTTCGTGTTTTGGCTCAAGCAGAAGGGCCTCCATGCCGCTGATGGCGAGGACTTTGTCGACG
AATTCCACCGTGCCACGGACTTGTACGCTGCGACCAAGTGGAAAGCGATCCTCCAGGACCGCGAGAGCGTTGCAGCGCGCGTGTTCTCGCTGCCGGCGGT
CGAGCGCGTCGTGCATCTGATCCGCGGCATCTACGGCGAGCGCAGCGGCCGACGATCTCGCAAGGAATCCTTTTAA