Description :
From Genome Similarity Track
Location :
Scaffold_512:5876- 7754
Transcript NameFunction/comments
g16095.t1hypothetical protein
g16096.t1XP_009532277.1 hypothetical protein PHYSODRAFT_516045 [Phytophthora sojae

Sequence
1878 bases(100 bases per row)
ACTATGGCAATAACTACAACAGCAACTACGGGGAGAGCAATTACAACAGCAACTACGCCAGCACCACGTCGACGCAGTACGCGGCTGGTGCTGGCATGGT
CCCTGCTAGCTACGGCAGTCCGTCCTCGATCGACATCGACGATGACAGTCAGATCCGCCGCACCGACAGCATTTTGGGCGGCACTGGCGTCATGTCTAGC
ACCACGTCGAGCCAGCAAACCCCGTTCGAGTTTAGTGGCGGGCCCAGCCCTGTAGGCACCGCTGCGAGCCGCAACGTGTGGGGGAACGAGGCAAGCAGCT
TCCGTCAGAAGCGTACAGCGAGTGACGTGTCTGTGGAGTTCTAGCTTCGAAATCGATATGTAACCCCGCGAGGGCAGCGCGTGTTTTGTCTATGAGTTAG
AAGTATCACGCGCGTGCCTTTCACGAGGCTGGAAGAGGCTAAGCAATATTTGATGATCCATGTCCATTCAGAGCGCACCCGGAGTCGTGTTTACTTGCAT
CTACTGCCATTTTTGATCTGGCAGGAAGTCTAAGCTGTTTAATTTTCTAGCGTGTAGAGGGAGAACGCGAGCTGCGAGCCGAAGCCTGCAGCAAAGCGTA
GCGCGTACTTGTGGTTGTGGGCTCCTCCCGGGGCGAGACGGAGAGGAGTCTCGCCCAGGTTCGGGTCGTGAGCCTCGAAGTGCACCACAGGCGGTACGCG
ACTGCGACGAAGACCCTCGATGGCTGCTACGTCCTCGAAGGCCACAGCCATCGGGTGTCCTGTAAAGCCCTTTGTGTTCGCGATCAGTAACTCCGCAAGC
AATTCCGAACCGAAAGCCGTGCGCAGTGCCGTCACTTCCGTGTACGCACACGAAGACTTGGCCGACGCGTTGGTGCCAGTCTCGTGGCTGTAGTAGACTC
CGTTGCGAGCGATCTCCTGGCGAGTGATGCCGAAGTCACTCTCTACGCGCTGCAGGAAGCGCACGAGCTCTTGTCCAACGTGGTTCGGCTCCAACGCAGC
GCCGTGGTAAGCCGAGTTACTGAACTGTGTGGCGAGCAGACGCACGCTCTTCTGGCTGGTTGGATCAGCCACAGGACGCTCTGCAAAAGCGAGCGGAGAC
TCCAGCACCAGACCGATCGCTCCACTACCGACAATCATGCCACTACGCTTCACATCAAACGGACGCGCCGCTGCATCCGCCGTCGGAGCGATGCACGAAG
CACCAAGCGCACGGAAACCACCACCAATCAGCGGCATCATAGTCTCCGAGCTAGCAGTGTCACTGGACACCACGAGCACACGCTGACACTTGCCAGCGTT
GATCCAGTCCTGGGCCATACCAATGGCCTGCGTGGCACCTGCGCACGCCGCATTAACTTGAGTGTTGGGCCCGCGAGCTCCCGTGAGCTGAGCCAGCTGA
GCGTTCGCGAGCACCAGGAGCCGGAAAAGAATCTTGCGATCCATTTCGTAGGCGGATTCACCCTCTTTTGTGCTGCCCTCGTAGAAGCGGGAGGTCTCCG
ACACTGCCGCGTTCATAGTAGGGAAGGATGTAGCGTAAATGACGCCCGTGGAGTCACGCATGTTCTCAGGCAAGTGCCAGTTGGAGTCAATACCATCCGC
GAGGCCAGCATTACGGATAGCCTCAAGACCAGCAGCCACAGCTAACTGCGTAGGCTCATCCATCGAGCGCGCGATGGTGGCGCTGATGCCATAGTCCTTC
TCAAGGTCGACGTGGTTCACAACAGCAGACACTTGGATGCACTTTTCGCGGGTGGACACCGGGTCACGCGTCACGTCTCCGGTGGTATTGTCCTTACGGG
CTTGCACGATGTTCTGGGCAATCATTTTATCCTTCTCCGCATCTGTGAGCTCTTGGATGCAGTTCTCACCTTGCAACA