Description :
From Genome Similarity Track
Location :
scaffold_66:58752- 61145
Transcript NameFunction/comments
Pl_110638unnamed protein product

Sequence
2393 bases(100 bases per row)
GCACAGATACGATTGATACGCCCATTGTGGCATTCGTAGCACTGGCAGCTTCTGTTCAAACTCCCTGTCTGTCAGGCGCTTATCGATCGGTGTCACAAAT
TCGTAGCTGCTAAACACTGGACCGGCGTGCATGACATTATCGACGACGAAAAATCCCATTAGTGGGTTGCCAGCACCAAAATGTAGCACCCCTCCTGGAT
CGCAGTGTTCGGTTGAGGGTGAATCCGTGTGAACGTCCGCCACGATCACGTCGCTTTTGCCAGAGTCGTCTCGGCTTTCGAAAAATAAACCGGGATACCA
TCCGCAGTATCTCGATCCTCCGCTTCCGAATCGCTCTTCCATTACAGTCTTCAAGAAGTTCACTTGATTGTCGTTTAACGGTTTGCGCTCAGCCTGAAAA
ACTGCAATCTCTTCAATCGACTGCATTGTTTCCGCAAAAGAACGAAAAAATCGTTGGGCTTTGCGCACGTAGCACTTCCCGCCAGAGTGAAGTGAGTCAA
AAGAAGTCAAGTACACTTCTTTGACTGGTTGTGTGAAAACTCGGCCAATGGGTCCACCACTCTCAGGATCATATTCTCCATCTGCATTGCAAGCTCCTTC
ATTCGCTTCCAGAAGAGAGGGTACGGGTCTACCATCCCATCGGCGTACTCGCAGCCACACATCATCGTATAACTCTGCTTGGAGTAAAGCAAGGTATCAT
GGCGTAGCTGAGAGAACGACGCAAGCTGTGTATTCATTTTGTGGTGTTGCCAGGATTGGGAGTGGAAGGTATCAGCAGCATTCGGCGACTCTCGTGACAG
TTCACGAAGAGCTTTTTGCCATAGCATACTGATGATCGTACTTTCGTCAACAGCATTTCCACTCTTGCTCTCTTCACTGTCAAATTCTTGATCGATAACT
TGGCGAAGAGCAACAAGGTTTGACGAAAACTGGATTCCGTCTCGGAAAGGAACAAACTCCTGAGAGTTCAATGAGGCTGAGTTTGGTGGATTGGTATTCA
TTCGATTTGCCAGAACTTGAGTAGCACTGTTATTGGCAAACAGTGTGAAAGCGATGTCAACTGCACTTGGAATGCGTCGCTTCTGTTTTACATCGTTGTG
GAGCACTTGGTCGAAGACCAGTCGCGAGAAAATGAATGCACTCCAAACGAACCGCTGTCCAAGTAACGCAAAAGAAGTTGGTGGAGTCATAGGTACCGTC
GAATTTAATGGCTCATTTTCCGTACGAGGGTGTCCATTAATCAATTGATTCCCAAGTCCTTTTTGGAGAATCTGTTTCTGAATACCCTCCAAGATCTTTA
GACGTTGATCATCATCATCTACCATTATGTCTTCGGTTGACAGAAGTCGAGCAAGTTGCGTGGGCGAAAGCGAGTCCGATCCCATCCCACCATCAGCCAC
CAGACTGGAGATCAAGGAGTCAACACTCTCCACAACCTCCAAAGTTTGAGCTTCGAGTAGGAATCGCACTAACAGAACAGCACAATGCAACTGGTGAATA
TCCTCGACACCATTGTCACCACCAGCTACACGAAAATCGACTGTGCCAAGCCATGTTATGGCACGAAAGTACCGCATCAATTCTTCAGATTTTGTATAGT
GACCGCGAGGCTTGAACTGCGAGAAATCAACGTCACGCTTTGCAGAGAATATCTCTGTTGTAGTTGTTTCTTCTGAATGAATCATCTCAAGTAAGTGCTC
CTGTTTGAGCGAGTTCTCAGAAGGACCGTCCAGTGTTTCACCTTGTAAGAGACTTCGTGCCACTCGGAGAAATAACTCCACATCCATCATCGCTCTTATC
TGGCTAGAGTCATCCTTTGGAGCACAAGAGATGGCGTCACAGCATTTAGAGAGCGTAGATTCTAGGATTTTATCCAAAGTTTGAGATAGCACTTCTACTT
CCAGTTCCACCAGAAAAGCGTCAAAACTGCGATGCCACGCGTGTAAGATCGAATCGGCCGTCACGAAGACTGGCATGTCATCTGAATACAGCCGATAATA
AATATCAGCAAAGCTCTCGGCCTGCATGCGTTCCGCCACAACGAATCCATTAGCAGCCAGTCTAGCTTTCTCGCTTGCTTTGAGTCGATAGTCAGTGGTT
TGTATCTTTTTCAGTGGATGATGCGTTCCTGACATCATGATTTGGTTCAAGTACGTAGATCCATGTTGCTTCTTCGCTTCTTCACGGAGACGCTCTGTTT
CCTTACGAACTTTCACTGGATCTGCATCAAAAAGGTCAAAGTATTTACAATCTTCCAGCACGATAGACGCACGATCTTCCTTAGATTGTGCAGGGTACAG
TTTCGTGAGGTCTTCAGCCGTCAAGTTCGCGCCGATCTTCTTTAACGTCGCTGCAAATGCAGCCCCCACATCACCACCACCCATGCTTCTGTC