Description :
From Genome Similarity Track
Location :
scaffold_75:58741- 60825
Transcript NameFunction/comments
g2848.t1hypothetical protein

Sequence
2084 bases(100 bases per row)
CTTGTAGTGTAGTATCGGTACTAGCTAGGACGCAAGAAGCGCATGGACCAGGAGCCGCACATCAAGGCCTCAGACTACGTTTGCTTGGAATCCTGGAAGC
TCGTCGATGTCGACCCTTTGACCCGTTCTCGCCACCTGCAACAAGTAGCGTCGAGGAATGCCCCCAGACGATCACACGAAGCACGTTGTCAACGCATCGC
GTCCCCGTGGCTTAAAGCGGTATCGTAACGCCATGCCGCAGGGAAACAGCCAGGCTTCAGCAAGTCGCATTGCTACGGTAACCTGAGCAAATAGCCCCTT
GCTTGCGACTGCCGGGCGACAACCATAAACTAGTTCGTTTTATTGGAGTTCATCTCCACTAGTCTAGTCTCGCAATAGCCTTCCGAGTTCAAGAGGCTTG
TGTTCATCTCCAATAAAACGAACTAGTTTATGGTTGTCGCCCGGCAGTCGCAAGCAAGGGGCTATTTGCTCAGGTTACCGTAGCAATGCGACTTGCTGAA
GCCTGGCTGTTTAGCGTCTTTAGCTAGAGAAAAGGTGGATAAGTGGGAGCGAATTCAACACAAGCGTTGGAATCTGTGCGTTAATAGCCACGGCCATAAA
CCAAGGCGATGCATCGTTGACGCATGGTTCTTCTTCAATTCCACAAGCCGTTGGGAAGGGGGTCTATCGCAGACTCCAATTTGTCGGTGCGAGGCTTGGG
CGTAAAAAATGTCGGCAATGGGCAACACATCGGCACTCCCAACTCCGATGATATACTCCGTCCACGGATGGCTGTCTAACATCACGAGTTTTGAAATACC
GCAACCAAACTCTGAAAAAGTGCACGGGAGGCATGTCGTGCCAAGTGAAGCAGTCGTTCCAACTGTAGCATGGTCAATCAGCGCTTTCTTAAACGAATCT
CGCGTCAGTGGATCTGGAATTCGGAAGGGGGACGGAGGTACAGCGGCGCCACCAGCAGCAGCTTTGTCATTGGCTTCGTTAACGGCTTTGACGAACTCAT
CCACACACTTCCATGCGAAGATCAATATAGGTGCTTGGTTGGCGTGTTTCGCCAGCTTCACGATTTCGTCGTACAGGTTCTCTTCACCATTGCGTCGAAG
TACGTCTTTCAAAGCCACTGGAGCGTCGCGTTTCTTCTTCGCAATACTTATCTTGCGGCTTGCCATCGGTCTGTTTTGGCCTTGTTGTTTTGCAGAATGA
GCTGCGGTAGTCACTAACTGCGTTCTCGTCCCACCTGTATTTTCTCAATTAGTGATTAGTTTTTACGAAGTCTGTGTTTTCCTGGAAAAGTTCTCTAGTT
TGATAGTGTCAAATTGTGTCAAATTGACACAGATCTTAGATATCGAATTCTTAGCGGTGATTGGTCAGTTTTGTTTAGATACAGCGATCCTTTTGAAGAG
ACGCAAATCAAAAGTCAAGTTGCAGCATGGCTCTCCTAGCCTCGCTTCTGGCTGTATGTGGGCTTCTGGGCTTCACGTGGTGGCTATTGGCTCACTACAA
AGATGCAAACGTTCCTACCGTTGTGCACGTCGCTGTATTCACGAGTTGGTCGCTGGGTTTCCTCGGTTTACTGCTACTGCCAATGGATCTGGCTACCAAT
GGTCTTGCGCAGTCTGTCAGTGTCGATACAGTGGATAAATCCACTTTTAACGAGTATCTAGCAGGTTGGAAAATGCTGTACTGGACGACATTCCTTATGA
GTTGGGTGGGGCTTCCGTTTCTGGTGGAATTTCGTCAGAACGGGGAGTTTGAGTTGGACAAGCGCGTGTTGAGTTCGTCCAGGAATTTGGTATTCCATTG
GACGGTTCTAAGTGGGGCATTGTTTATTGTGGCTTTGTACTTGATCTTTGTCGACCATTTATCGATCTACGGGGTCTTGGGTCTTGCTATGGCGGCCAGC
AACACGTACGGGTTACTGTGGGTCATCGCCCTGTTGGGTTACGGACTGGTGGAGATCCCGAGGGGCTTCTGGATGCGACGTCTGGATGGAGCACAACTTC
AGAAACTGCACTTCCAGGCGGTACAACTTCAAGATGAGAGGATGGAGGCGCGATTCGAGTATGATGAAGTGGTGGCTGATGTTC