Description :
From Genome Similarity Track
Location :
Scaffold_165:58727- 61998
Transcript NameFunction/comments
Physo_144089hypothetical protein
Physo_144090hypothetical protein

Sequence
3271 bases(100 bases per row)
GCGTCAGCCGAGCAGCGAGCGATGGCGAGCAGCGGCGTGGACGTGGCGCTCGCGCCCAACTCGAGCGTGATCCTGGAGCCGGCGGACTCGCTGTCCTTCC
ACCTGCAGCCGCAGACGGCGCCCCAGGCCGTGCTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACCACGCGGCCACTGCG
CTACCTGGTGCGGCCGAACCAGGGCCTGCTGGGGCCCAACGGCTCGGCCTCCATCATGGTGATCCTGCAGCAGAAGGACTGCGACGAGCTGCTGCGCCTG
GACCCGGCGGAGCGCCAGCTGGCCAACGACAAGTTCCTCGTGCAGAGCATCTACGTGGACGACAGCTTCTACGAGCTGGTCAAGACCAAGTCCACCAAGG
AGATGGCGGACGAGCTCACCAACATGTGGGCGCGCACGGACAAGCGCGCGCTGTCCAACAAGAAGCTGCGCTGCCGCTTCGTGCAGGACGGCGAGGAGCG
CCCGGCCTCCCCGCCCAGCCCGCAGCGCGCGTCGTCGACGAACGTGTCGCCCGCCAAGACGGCGGCCGCGGCCTCGGACGCGAGGTTCCAGAATAGACTC
AGCGACGAGGTGAGGGAGGAGGTGGCCACGCCCGCGCAACTGTCCTCGGCGCTGCTGCAGGACGACAAGCCGCAGGCGCCCAAGGTGGCGGAGAACAGGG
AAGGAAGCAAGGAGACGGTGCAGGAAGTCGCGGCGCTCCGCAAGAAATACGACGAGGTAAAGTTTTCCCAGAAGGTGGAGAGGAAGTGGTCGAGTTGAAC
GGGGAGGCTGATGTGTTCTTGTGTGCTTGTGTGCTTGCAGTTGGTGGCGTTTACAGTGCAGCTCACGGCGCAGCGTGACGTGTTGATGAGCGACCTGGAC
AAGACCCGGCAGCTGCTGCAGAAGGCTAGCACCGACGCACAGCGCGTGAAGAAGCTCTCGGAGGAATCCTCGACCATGCGTCACCGGAAAAACGCCGGTG
GCAATGGTGCATCTGGCAACGAAGACTCGCAGGCGATCACGGGCAAGGGCCCGAAGGAGGAGGGGGTATGTCTGACGTATTTCTTCGTTTTCTGATCGTT
GGCATGGTGTTATCATAACTCACTGTGATTATGTTGTTGCTACAGGCATTTGGACCCATTCATCTACTGATCTGCGCGATCATTTTCTTTTTAGTTGGAC
GCTATTACTAGGCGACGTGCTGTACCGTGTGCGATGGAGTTAGGCAGAGACAGAAGGTGTTGCAACTCAAGTTTAAGTGGGGAAGCAACAGTACGCTTGG
CGAAAGGAGTGAGAGCATTAGAGCTTTCTGTCGACCTGCATGGCCGACGCGTGCTTGCGCATGTGTATGTGGGCTCGCAGTTGAGGGGAACTTGGCTTGC
TGGAGGTAGAAGAAGATCATGGAGCAGCATTAGTAGTAGACCGAATGACCGAATGAGTACAGGAAACCAGGGGGAATGAATGAATATGCCAACCAGCTTT
CTCTCGGATTGTTGGATGGAGCAACGATAGATAAGCAAGGACGCTGCGGGTAAGCGCAGCGCATCTGGTGAACTTGGTGGTGCATTGATAAGAAGCATGG
GCCACGAAGTCTCTCGCCTGTAACTCTTCTTGTATGGCCAACTCTTGGCAGTGTAGGTTGTGCAACCCTGGATGCAGCGCCACCTTGCTAGTTAAGAATC
GCAGTGACGCTCATTTTGCGCTTCCCCTCCATATCCAACGGCGCACATGCTTTACGCTTGGCACTACGCGTGCGGCAGCTTTCCGTGGCGCTGCTGTCTC
CGCCATCACTGCTAACTCCAGACGCGCGCAAAGCCGCGCTCTCTTTCATAGAAAGCATGGCCATCGCTGCGGCATCGCTGTCCGACTGGGTACCAGCAGG
CGCAACACGCAACGGCAACGGGGGGAGAATCGCCTTTTCTTCTTGGGGACGGCCACCAAAGCGAAGCGGCGGTACTTCTGCTTCATCGTCAGGGAAACTT
GTATCGTCCACGTTTTCCTCGTACTCTCCGTCGCCGTCATACGCGCTCTCAATCTTCCGGAGTTGCCTCACATCGTCTCGAAGCGCGTTTACTCGCACCA
GCGTTACCGAGTCTTCCGATCTTGGAGACGCTTCATCCACCGCGCTTCTATACCTGCGTCCATCGTGACGACCACCACTTGCGCCTGGAGGGGTGTGGCT
CGGCGAAATGCTTGACGAATTGTTGTTGCCCGTAGACGCATCCTTGCCGCTAGCGTCACCACTTGGTGGTCCTGAACTGCCGGGAGCTTCGCCCGAAGGT
GAGGACGATGAGCTCCCTCCGCCGCCGCTGCGTCGAGAGGACGACTTTTGCGCGTCGTGCTGCTCAATGCTAGATCCCGTAGCCTGCATGAAGATGTGCT
CCAGACGATCGATCATGTGCAGCAGCGGCTCGTACGTCGCGAAAGGCTGCTTCATCAGGATCGTGTGCATGAACTTGTTGCGCGTGGCATATCCCGTCCA
CTTGTCGTGCTTCTTCAAAATCTGCAATACGCCATAACCCAAGAACAACGTAAGACCACTGCTGCAACAATAAATTGCAGGCGGAAATGCTGTCAGGGGA
CGAACCGCCTGACTCGACATGTAGTCAAGTGGGTAAGAATCCGACCTTGGAGATGCCGCAAAAGTTCATGACGGCAAAGTTTTCCAGCAGCAGCAGCTCC
TTGTACAGAGCCACGCAGCTCTTCATCAGCGCCGTCTTCGCTTCAGCCGAGTCGGGATTCGTCTACGAAGCGCCACAGAACACGTAAGACTTCCCTCCCA
ACAAAATAATTATCGTCCAGCGATGTCTGATCCGCCCGTACCTTGAGCTGCTGGAAGCTGGCGTCGATGGCCGCCACTTGGCTCGTGTGCCTGGCCTGCT
CCTTGATGAAGAAGTCTGCAATCTTCTTGATCTCCATGCGCAGCGTGCGGAAGAAGTTCATCTCATCCTGCGACTGGCCTGCTCCGCCAAAGCACAACGA
ACAATAAACATCAATACACGTGATAACACCCAAAACGCCGGTGCAGCAATAGCGCAACACGCACGGATGCTGTCGTTGTCCTCCTTGGCGGAGGGTTTGA
TCTTGATCTTGACGAGTTTGTCGCCCTGCAGCTTCTCCTCCTTCTTGATCTGCGCGCAGTCCTTGATGATCTTCTTGAGCAGCTTGTAGTCGGCCCAGTA
GGGCTCCCACGCGCTGGGCGACATCTGCGTCGACTGCTGCAGCACCTTGCCGAACTTCATGGCCCTCTAGC