Description :
From Genome Similarity Track
Location :
contig_17:587210- 588853
Transcript NameFunction/comments
g4847.t1RAW34445.1 hypothetical protein PC110_g9241 [Phytophthora cactorum

Sequence
1643 bases(100 bases per row)
CGTTCATGGAGAACATCCTGCGCCGCAAGCCGCTCAATGTCATCCACGCCGAGGAGTCGGCGGAGCAGCTACCTCGCCACTTGTCACTCTTCGACTTGCT
GTGCATAGGTATCGGAAGCACCGTGGGCAGCGGCATCTTCTCCACTGCGGGCGAGATCATCTCCAGCACGGCGGGTCCTGCGGCGTTCCTCAGCTGGATC
ATCGCCGGTGTCGTGTGTTGCCTCAACGCGCTCGCCTTCATGGAGCTGGTGACGCGTATCCCGTCCTCGGGCAGTACGTACGCCTACTCGTTCCATGCAC
TCGGCGAGCTGCCGGCCGTGGTGGCCGCGTGGCTGCTCACACTCGAGTACGGTATCTCTGGCTCCGGTGTGGCCCGTAGTTGGGCTACCAAGGTGCAGGA
GTGGCTCGTGGAGGAGCACCCGGAGCACACGTACCAGTGGCTGAATGAGGACTACACGAACCTGCTGGGAGCTGTGCTGATGGCGCTCTGTGTGGGGGTT
CTCCTGGTGGGGTTGCGCTTCGGCAAGTGGTTTGTCAACACCATCACCACCATCAAGGTGTTCATCGTGCTGTTCATCATCATTGTTGGCTTCTGCTTCA
CGGACTCGAGCAACCTCTCGCCCTTCGTCCCGCCTCGACAGGACGTGGACGGCACCATGGCCTTCGGCACCCAAGGAATCATCTCCGGCGCGTCGTCGGC
CTTCTTCGGATACGCCGGCTTTGACGAGGTGTGCTGTCTGGCTGCGGAGGCAAGGGACCCCAAGAGGATCATGCCGCTTGCTGTCATCGGCGTCGTGACT
GGCACCATGTTCCTCTCCGCCTTTGCATCGCTCGCGCTCTCGGGCATGATCCCGTATCTGGAGGCCCAAAGCTTCGGGTCTGGCTTTGACTACCAGGGCC
AGAACTGGGCGGCGCAGATCGTGCGCGCCGGTGAGACCTGCACGATGCCCGTGGTGGTTCTCGTGTGCTTCCTTGCCCAGCCGCGGCTGAACTACGCGCT
GTCGTGTGATGGTCTGATGCCGCGCATCTTCTCCAAGGTGGACAAGAACGGCAACTTGTTCGAGAACACGCTGATCTCCGGCGCTTTCTTCACGGTGGTG
GCCTTCGTGGTGCCGTTCGACACGCTCTGGGATATTGTGAGCTTCGGTATGCTGCTCTCCTTCAACATGTCAATGGCGTCGCTGCTGATGGTGCGGATGC
GCAAGGACTCGCCTAAACTGGCGCCCAGACTCGTTTGTACCATGGTTGCGTCGGCTTGTCTGGCGGCCTTCTTGTACCAGATCGGCTACTCCAACGAGGG
CCACGTTTGGTGTCTTGTGTTGAGCATTCTCTTCCTGGTGATCACCGTGGCCGTGTGCTTCGTGATGTACTTCAAGTGTCCGCAGGAGGCACAAAACGGC
GAGAACTTCGCGGCGCCGTTCGTGCCGTTCCTCCCCACCATCGCCGTGCTCGCCAACTTCTACCTGTCCGCTCAGCTGAGCTACACGGGTATCTACACAA
GCTTCGGGTGGATGGCTGCCAGTGTAATCTTCTACTTCGGCTACGGCTACAAGCACTCCGCTGGCAGGACCGGCTGGAGTGCACTGATGAGTCTGCCGCG
CGAGTCTTCGCTGCGCTCGCCCATGATTTCGGTCGACAAGAAG