Description :
From Genome Similarity Track
Location :
Scaffold_334:5872- 9869
Transcript NameFunction/comments
Phypl_g7096hypothetical protein PHYSODRAFT_507552

Sequence
3997 bases(100 bases per row)
GATACGCTTTAACCGGAGGCTACCGCTCTGGCAGGTGAACGTGGGCACCAATTTCAGTGGCCATGTGCGAACCGCGGCGTGGCTCAAGGCCCGGCTTTGA
GCGTGAGCCCCGGAAATAGCTGTCCATGGATCTCAGCATGTTGCCAACAGACCCGCTACTATGTCGTCGTGGATGGGTGATAACTTCTGATGCTGGGGTC
ACATCTTCGGTGATGCGGTTGCGTGAGATGAAGCGAGCCCGCGAGGCAGTTTCTGAAGACGAGCTGCCACCACTGCCTACCTGCTTGTTCGTGCTTGAAC
CGCGACCTGTAAAGTGTGATCTGGAATCGACGGAGAACATGCCCGAGAAAGGAACTGTTGTGTCACGCTCGGACGAGTCGAAGCACACCGCGCAGActcg
ctccttctcgttgaCAGCTTCAACAATCCCATTAAAATACCGCGCTGACCCATGCACTCGAGCCATAATGGCCTCTCCGACAATGAAAGTCACAGGCGAC
AACTCGAAGCCCATCGTATCGATGCTGTAGTTGGTCAAACGCTGCGTATGAGACAGCGCAGTAGTGTCATCCAGGCAAGTGATCTTATCGGCCGGCATTT
GCGTCTTCTGCTCACCATAGTCGAATACCAGCGTGTATAACGAGGTGGACACTGAAGTCACTGGCATCGTGACAGAATGTACCGTTGGGGACGCCAGTGC
TTCGACACCAGAGAGTGAACGCACCGATGGAGACACCAGGACTCCAGGTGCACCAGTGGGGTCTTGAGATATCTTGGAAATGATTTTAGCAGAGCAGTAG
CGTCCGAAGCGCGAACTCCAGGCAAGCACGCAGTCGTCCACCGCATATGTCGGCACCTGGCGCGATCTGTTGTAGCTGTCGTTTGTGACCAAAGAGGTAG
TGGCTTTTGTCTGCATGCGCTGGTGCTCCACGCTGTCGATAATCATTTGAGATGGAAACACCTCAAACGCGATGGTGCCATCTGAAAAGCGCAGATCACA
CGCCGAAGAAGGGTGAACTTTGATGACAATGCAGCTCTCGACAGCAACTTTGCTAGGGTGGTCAGCCTTGACCTGGTATCCTTCTTCAAGCACTGGAAGA
TTTCGTTTCGCTCCACCGTTCGCAGCTGCCGAAGCCTGCATGAGAACAGCATTCTTGAGTGACCTCACGTCCTGGTCTGCAGGCACCCTTACACGTTTCC
GCTTGAAGATGAGGTGCGGGGGCACTTTGTATCCAGTGGAGCCGTCTGCAAAGTCTACGGCAGCCGTTCGATTCGAGTAAACGCCATTCAGAAGCCCCAa
cttttcttcttcgcttgAGCTATCAAGATCACCATTTCCAGCCGAGAACTTGACGTAGATCTGATCTCCGATGTAAACCTTAACTTTGTTACTGCAGACG
AGAAATTGATCTTCAGTAATCGTAACtgcggccttcttcttctcatGTAAAGGGCTGATCTTGTCGGCTGGAACATTCACTAACCGGATGCGGTTTGCAA
GCAAGACATGAAAGCGGGATTGATACTCCCGTTCCTCAGTAATCATGCCACGACCGCAAAAGCGACTACCTGGATACAGCGAAACGTTAACCTTTTGGCC
AGCAAAGAGGAGGCGCTGTGATTTCTCGAGGTCTGTCagttgctgctcgagctcacACACGGATGGCAAAAAGTCCACTTTGTCCTTCGGCACAACCTGC
ACAGAAATACTGTGCTCATCTTCAGTCACCACGGCGTAGCCTTCGTCATCGACTCGTTTCGTGACTGTGCCGTAGGCGCGCACTCCGTCAGGAGCACGTT
CGTATACAACCCGTAGACTGCCAGAGTCACGTCGAGGTACAGGGGCTGCAGTCGGTGATCCTGAGTTACATCGAGTTGAGCGCATACTATTGAGTTTTGC
CTCCATGAGGCGAACGTGTTCACCCAATACGAGCTCATCCGTAAGTTTTGAAGGCTGAACCTTTTTGTTGCCACGCATGAAATATTCCGTGATGACCTGC
TTGAGGCTCCTCGGTGTGGGAATGATTTGCTTCATGGCCTTCTGCGTTATCGACAGCCGATCAATCGAGGAAATGCTCGACCGCCGCCCAGTGCCGCGTT
GGGCACGAGTGGCTTTGCCCATGCCGAAAGTCTGTGTCATTTGCTGCCACGGCGTCATGGACATGTCTTCTTCACTTGACTCATCCGAGTCGCTGACTTG
AGTCGAGTCGTCCTCGTAGCCCACCCCGCATTCAAGCTTCTTCATAGTCAGAGTTTCATCTTCAACAAGATGTCGCCAAGTCTCGTTGTCTGTACTAGCG
ACACCACAAGGAGAGCCTCCGATTTCATAGGCGGTGCCATTGTCGTCAAAGCTTAGCACCATTTCTCTCGGCGGTGTGACTGAAAAGTCTACCATTACAT
GCTGTAATGGCAGAAGATGCATCTCTGGTGCTACTGACGGGTCTGGCCAGTAGTCTACACTCTCTTCACCCTCTTCACCCTGCTTTTGTGGCGACGTTTT
CCGTGCTTTAGCGTTCGCAGACGCTTTCGCAGCATCATCCGCTTCCAATCCGCTAAAACCATCAAGTCGCAAAGATTCACCGTCCTCCCCCTTTGAAGAA
CCGTCTTGATTTTGACGATGAGAGCTATAACGGCGTTTCTTCGTCTGTTGATttgacggagaagacgctgaagggTGTTCCCGAAGCATAATATCCTCGC
GACGAACACGATAGTCGAGTGTTCCATCGTCGAAAACAACCATGAACATGCCTCCTCCGAGATAGGTGGCGATGTTGCCCGAGTAGAAGCACGGTGTCTT
TTTGTATCGCCCGAAAACGGGTTGCCCGTAGGTCCACTGGCTGTGAAGCAGTACGAATCGTGAAGCAGGGCTGTGCGATGTGGATTCTGCGACTGGGGAC
GATGGAATATCAGGAATATCGGGGGCATGCTCGTGATTGCTCTCAGACTGGTGCGCTTCATGATGTTGATGGTCGTGCTTGATACCTTGGTCCTTAGTGC
CCCGGGTATCGATCGCCCCGGATGCCGTCGACCCAAACTCTTTGCTTATGATTGCCCCATCACCGTGAACCTGCAGTCGACCACTTGGCTGTCGACTCGG
AAGTATCGGTATTGTCCCTTTAGGAGAATTCTCCTGTCTGTTAGCAAGCGCACCATCGTCATGAAGTTTAATGCGAGTACTAAGCTGTCGGATTGGCGAA
AGCGGAACACTTCTTGTTGGCAGTTCGGGCTTGGTAGCGGTGATATCGCTGTTGTGCACGCGGAGGTTGTCATTGATCTCCTGCACTGATGACGAGGGCC
GACTTCTACATGGCGATACCGCTTGGATCTCCTGTGTACTCGCATCACCGTGAACCTGGAGTCGACCACTAAGCTTGGCAGCGGATGATGGTCGGCTAGA
CCCACTTGTGTTCCGAGTTGACGACTCCTGCTTGCTGTTAGCAGGCACCTCGATGTCTTGAGGCTGGGGGCGCGCACTATATTGTTTCGCTAGCGATGGC
GGATTATTCACCCTGGAAATCATCGGTGGAAAGTCATCTTTGCCTGTTAAAATGCCGGTATCCTGGACTTGAAAACGCCCACTGAGTCGAGAGTGAGATG
GCCTGCTTGTCGGTAGCGTCGTCGCCCTTGGTGAGCCATCTCGAGGCTCTTTCGGTTCGATCGGCACAAGGTCATCGTGAACCAATAGATGACCAGTGGA
CTGTAACGCAGAAACTCTGTTCGTCGTTGATGTTGGCATCTCCGCTCGGAATTCTTGGGTGGCTTCCCCGTGTATGGGGAAGCGGCCGCTAGGACGTCGA
GACGACAGCGGTCTCGTCGCCCTGGGGTCGGCTGCGCCAGCCCCGCGCATCTCATTAATCGGCTTCCTTCGTCGCTCGCTGCCTTCGGTTCACGTGGCCA
GCAAAGAGAAACCACAAAAGGATCAAGCTGGTCGTTGATCATTTTTAGCGCGCAACCGACTGTGCATCACCATTGTTGGTCCTCTTATTAtagctgc