Description :
From Genome Similarity Track
Location :
Scaffold_1342:5871- 6882
Sequence
1011 bases(100 bases per row)
CCTTGAAGCCCTGAGCGGGTACACGACTCGTGCCCGTGGCAAACTGCAGCAACCGCACGCGGTCTTCGTTCTTCATGTCCTCGATGACCTCCCAGAACCA
GTGGATGTTGCTCAGTTCCAGCTCCGTCGGGTAATTGTGTGTGTAGAACTTGAAATCCGTGTGCTTCTTCCAGTCCTCCACGTCGATCGATGGCACACCT
GCAGCACAAACAATAATAAATAATATAATATATATTTCCAGTCAGCATCAACAAATTCCACACAATAATAAATAAATCCAGCCACGTACCACACATGAGC
AGCTCCAGTTCCTGGTAGTCAAAGAGCTTGAGCAAGCCCTCGGGCACGACGTCGTAGAGTGCAGTCAAGAAACTCAGCAGCTGCTCCGAGACGCTGCCCA
GCACGTGGTACTTAAAGAGCAGGTCGAGATACTCCTTGCGGTTCGCGCACGTCACGTCAATGTTGGAGCCGTCGTCGACGAGCTCGAGCACCTCGGGCTT
GCCGTTCACGATGCGCGTGACTGTAAAGTCGAGGCAGAGCGGCTCAATGTCGTCGATCTGCTTGACCATCATTGCGCTGTTGTAGATCTCGTCGTCGAGG
AACTGCAGGTCCGAGAACGAGATGGGCACGCCCAGGATGTGCTTGAGGAACGGCAGCGCGAGGTGCACGGTCACGAGGTGCTCCTCCAGGATTGCCTTGC
CCAGCAGCCGGCCTGCAAACTCGTAGTACGCTAGGTGCTCGTCGCGGAGCTCGGTCGAGTACGTGTTGATCCAGTAGCTGCGCTCGTCGCCGACCGTGGA
CACGAAGAGCCCGAACTTGGGATCGAAGAGCTCCGAGAAGAGCAGCGTGAACCACTCGCGCATGACGCCGCCGGCGTCCAGACCCGGCTCGCCCGCAAAC
ACGACGCGCCAGCGCTGACGGAGCTGGTAGGGCTTCATGGCGCGCACGAGGTCGAACGAGTCCTGGAGCAGGTTGTCGCGGCGCACGACGAGCTCGGCGT
GGCCCGACTCC