Description :
From Genome Similarity Track
Location :
Scaffold_66:58708- 60358
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_66-snap-gene-0.31Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_66-fgenesh-gene-0.16Peptidase

Sequence
1650 bases(100 bases per row)
AAAATGGACGACATGGCGGCGATGTTGAACGCGATGGCGGgTGGATTACAGCAGTCGTTTGGCTCTGTATTCGAGCGTGTGGGTGAAAGCcTTGCACAGA
GTGCGCAGATGATGCAAATGATGAACGAGATGATGGAGGCGGCGATGCTACAGAGCCTTACGGTCACCTATGAGGTGCGAcGAACCACGGCTGTGCCAGG
CCTCGAAGCGCTCCTGCAGATCGAAAATGGCTCCCAGATCCGACTCGAAGAGGTCTCGGTCGAGCTGCTATGTGTCACTGATCAAGCTGAAGCAACGCAG
TCGTTGTGCTCGTCAGCATTAAaGCACGCGCTGGACGCGAAGGCCACTACAGAGGTCGTGCTACCACTTCCACTCGGGGTCATTGGGAACGCTAagATCA
TTCGCTTGGTTGTGCGTAGCCCCGGAACGCATCAGCCAGTCTATAAGGATGTTCGCTTTCAGATCCCGGTGCTAAAGCTTGCATCCGTGCAACCAGTAAC
TGCTCCGTTCACGTTTGATGATCGCCTTGTCCAGGAATCGTCGGATGTTGTCTCTCTGCATAGTCTACGGGAGGCTCTTCATGTGAGCGCTTTTGACGCG
CTGTTGACCTCTGAACATGGGTACTATCGGCTTGAcGTCCCCCcTGGCATCATaGGCGATCGTGCTCGaCACTTCGAGCTTGCGgTtGAGAAGACGAGCG
AGTCGACGAGTGGAGTTCGCGTCCACATTCGAGCACAGGAGGGTGCAGAGCAAGCACAGAGCCAACAGGACTGCAGAATGTTtCGACAAGAACTAAAGGA
ATTGTAATGTCGCAACAAGAGTTTGTCATTGTGTTGTCTTGATGCGCTATTGATCCTCTACGAGATCGCTTCTCTTCGATGTCCAGTCTACGCCTTTTAA
GCCCACTGTCGCATCTGAAGGTAGCCACGGTCGCTGAACCACTTGTGCAGGAGGAACGACTGTCCGCCGTACATGATTGCGAGtGTCATGATCTCAAAGG
TCGTGTACCACATGATGCGGGAGTTGTTACTCTCAAGAGCTACACCAGAGCACTATTGTTAACAACATACACGAGCGCTTTATCAGTCAACAGCACGTAC
TGTGGCGGTGGCGGCGCTCGCGAGTCTTGTAGTATTCCTGCTCGTTCTTGATCAGATCCAGCAACGTGCGCAGGCGGTTCAGTGACTCTGTCACGCCTTC
GATGTGCTCTGTTCACGTCAGTTAAGATCCAACGGTCAGTCTTGAGGCGAATTCTCAAGGCCTGTAAaGTCTACGCACGCTGCTTGGCCTGCGCCTCAAT
CTGGTCTTCATAGCCCAACTCTTCCTCGTTCGAAAGGTCGAACTTGGTGTAAAACTCGACGACTTTTCCTTCATACGAGCTGTGCGAGTTGTCGAGGCAG
AACTTGTACCAGCCGCCACGGTGTTCGCTCTCGAAGTTGAAGCCATTATGCTGCACGTCATTGCTCACCTGATCGCGCTCcGTGACGATCAACTGGTCGA
AGAAACTCATCGTCGTgTCGTCCTCTTTTGGTTCGTTCGAGAAGGGGCCGTAggCCTTCAGTCGGATGTCGTACGTGTCCTTGGATTCGAGCACTCCGAT
CTTGAGGAATGCTGTGCGCTTCTGGCGCACATACTCGAAGAAaCACTCTT