Description :
From Genome Similarity Track
Location :
Scaffold_1:5870442- 5898657
Transcript NameFunction/comments
Physo_478462Probable E3 ubiquitin-protein ligase HERC4
Physo_310844PREDICTED: probable E3 ubiquitin-protein ligase HERC1
Physo_468590tRNA methyltransferase 10 homolog B
Physo_410657Hypothetical protein
Physo_355168ankyrin repeat protein
Physo_248423conserved unknown protein

Sequence
28215 bases(100 bases per row)
GTGCTCCACACAAGATCCACGCAGCGAAGAGTCGCAGACTGCTCGCCGGCCGCCGTTTGATGGATCGATCTTCCGCACTGGTCGAGTTGCCCCAGAAAGA
CAAGAGCGGGCGGGCATACAACAGCAACAGCAACTTGAAGAGGCCCGGTCATGGGGCAGCAGGTCTCGCTTCCGGCCGCGGTGACGCAGCCGCCGGGCGA
GCGCGCGCAGCTCCGGCCGCTCCAGGCGCCCTACGTGCCGCTGTGCGACGTGCCCAAGGCCGGCGACTCGGGCGTAGCCGTGACGTCTGCAGCCGCTGAG
GATGCAAAGGACGCCATGGACAAGATCCTTGAGTTTAGCGCCGCGCTGCGCTACCTCCCTGAAGGTACTACTTACTGGTGACCATTCCAGCTTAGAGGTA
CATTGCCAATTGACAAAACGACTAACGCTGATCACCGTTCGATGCAGAGAGCGAAGTGTCGGGGCGCCTGCACACACGCAGCCCCGAGCAGCAGCTGAAG
GAGCTCATGAGCTCCGTCGACTCGGTGGACGAGCTGTTCCAGCACATATCGCAGCTGGCTGGGCTGCCGGCTCAAGACGCACAGGACGGCAAATGGGACG
TGGTGGAAACGATGCCCGGTATCTTCGACGCTCGAGTGGCGGGCTACGTGAAGAACCTGCAGACTCTGTACCAGATGACGAAGAAGGAGAAGTACCGCTA
CGAGCAACGGCTGCTGGCTGCTAGGGCACACGCCATGTCGCTGCGCAAGGTGTCGCCGCCGCCACTACCACTTCCAACACAGAACTGCATGACCATGGGC
TGGGACCTGGTGATCATGCTGCTGAAGGCAACACGCACAAACAATCCAGAGCAGTACGAACAGGCATTACAGATGGTGAAGGACAACTTGAAGCCCCTCA
AGCCCACCGCCTACTCGGACAGCATGTACCTTGCACCGTCCGCGTCATCGGCTTTCAACCTTCTGAGTGACTGTCTCGGAGACCTTGCTTACCCGGTAAA
AGAAGACGATTCTGGAGGCGAAATGCGCATCGGAGCTCGAACGATCGAGACATTGGCTGAGGTGGGGCTTGCCCGCGGCTCACTTGCTACCATGCTCTTT
GTGGTACTGTGGCTAATGAAACAACCACCTACGAGTGCGGTGAACTTGGAGATGTCGATCGCAAAACTTGCTGCGCTCAAAGAGCAACCTATGTACGGCA
AGTGCGAAGCCTCCGGTGAACTTTACAGTTGTGGACAGAACTCGTATGGAGAGCTAGGCACGGGCGATGATATCGAGCGGCATCAGCTCACCAGCGTCTC
GCTCTGTGGATGGGACGACATTCGCCAAGTGGTTAGTGGAAACGAGACACTGGCGGTTCTCACGAACGAAGGTGTCGTGCTAACATGCGGACTGAACAAA
AGCGGCCAGTGTGGCCAGGGGCACTTCGACGAGCGAGTGATGATGCTCCGTCCTGTACAGGCACTGCGGTCCCAGCGAGTGAAGTTTATCGCTGCAAGTA
ACGGGTGTGAGCACATGATCGCACTAACGGACACCGGACTAGCGTACTCATGGGGATACAATGACAGAGGACAGTTGGGTCATGAAAACTTGGCCACCAA
GATTCACGTTCCCAAGTTGATCGAGTCATTGAAGGACAAAAAGCTTGGATTCGCCTCCGTGAGTTACCACCACAGCGCAGTGATCACGGATGCAGGAGAG
CTCTACACGTTCGGAATGAACGATTGTGGACAACTAGGTCTCGACCACACGCAACATCAATCGACACCGCAACTGGTAAAGAGCCTCGAAGCCACCGAGG
TATCCATGGTGGCTTGTGGGTTGTACCATACAATCATTTGTACGGCCGCAGGGGAACTCTTTACTTGCGGGAAGAATGACTACGGACAGCTAGGCTTAGC
TCACAACCGCCAGATCAAGCTACCCACACTTGTTGCGCTTCCGAACGAGATGGTCAGCTTCGTTGCATGCGGATACTACCACTCTGTTGTCGTTAGCACC
GGTGGCCGGGCCTTTTCATTTGGGAGAAACGATTATGGGCAGCTAGGCATCGGCAGCAAGGTCCACCAGAATGTTCCAAACGTCGTCGCTCTGTCGTCCA
ACACTCGGATGGTGCGAGCTACCTGTGGTTGCTACCACACAGTTCTGCTGTCCGAACAGGGACAAGTTTACGTGTTTGGAAGGAATAACAAGGGACAGCT
TGGCAACCGTGGCAGTGCTGACGCATTGCTCCCAGTTCCACTGAAAGTTCGTCCGGAGAAAAATTCTCGTCGATGTGTGGATGTTGCTGCCGGGTTTTAT
ACCACGTCATTAATTGTGGAGCGCAAACGTGAAAACGATGATGGTGACGTCATAATGCTAGACCAGAGCTGTGTCGTTCCAGTCTGCGGTCGTGTCGACA
TTGACCGGTCGGGAGAGATTGAGGGGCTAAGCAACTTCGGCTCAATATCAACAATTGGCGTGTCGCTATTCCGAGGCAAGTGGTTTTACGAGGTAGAAGT
GGTGACAAGCGGCTTGATTCAAGTTGGATGGATTGACGGCTACTTCCAGGGGAGCTCGGACCAAGGGGAGGGCGTCGGTGACCATGCTCATTCGTGGTCC
TACGACGGCAACCGCCAACGCCGCTGGAACAGTGGATCATCTTCGTACGGAGAAAAATGGAGAGCCGGTGATATCATTGGTTGCCTGCTTGACTTGAACA
CTCAAGAAATGACGTTTTATCGGAATGGAGTCAACTTGGGCGTTGCATACTCTGAATTCAAGTGCTCTGCAGAGGATAAGCGATCAGGAATGATGCCTGG
TATCAGTCTTGAACGTGGTGAAATCATCCGCATCAACCTTGGCCACCATCCTTTTGCTTACCCGCCGGCTGTCGGGCACGACTTCGAGAGCATTTCGCGA
GCTGTGACGATGCCTCCATCGAATGCAGTTGTTCAGTCAACCGTGGATGTTGCATTAGAAGGAATGCCAGTGCAGCCCCCACCGCTAGAGGGATCCGCCT
CAGCCTTGATTGGGAACAAACTGTTTGTTGTTGGTGGGATGGTGGTCAATAATGCTCCAGCAACCCAACCCAGCGAACCTACAAACCAAGTGTGGGTATA
CGATACAGAAACAAAAAGCTGGGATAGATGGACTGATTTCCCGATTGGAATTTGGCATCACCAAATTGTGACCATCGATGACGACCAACTACTTGTCCTT
GGTGGCGAGAACAATTGTGCAGCATCGCGGCACATGGATCTGTATAAATGTTCTACCGTGAAGAATGCGGATGGCTCGCTCCCAGCCTGGACATTGATTC
AAGCTGCCATTGGCGCAGCAACATCGATGCCGCAAGCCCGTGCATTTCACACAGCCACAACAATCCGTGTCCGCCTCGACACAATTGTGTTCATGTACGG
TGGAAAATCGATCGAGAACGAAATGCTCGGAGATGCGTGGTACCTATCTCTGGATGATTTCGCTTGGTCACGACTACCTAGTTCGGTGTCACTAGATCCT
GGCCCTAGAATTGGATGCTCCTCTACAGTCATTGGGGAGTGCGTATACCTATTTGGCGGACAGGACCGTGAAGAAAAGTTCAGATCAGATCTCTGGAGGT
ATAACACTTTTGACCGACTCTGGCACTTGTGTCATGACGATAACATCGAAGCTGCTAAAGACACAGCAAGCGGCAACTCTAGAAGTGACTATCAACTAGT
GCTTCCAGAGGGGCGCGTTAACTACAGCATGTGCTCCGATCTTGGAAATGTTTGGATCTTTGGAGGGTTGAACCGGTCAAATGCCTTGTTGTGCGATCTT
TGGTACTTCTCGGTGACATCCCAAAAGTGGACCCGAGTCGAAGTCAATACCCAGAGTGAAATGGAAGGGTGTTGCTCAGCCGAGTTGTTTGCCCGAACGG
GAGCAGTGACAGCCCTGCCCAGCCTGTCTGATTTCGAGTCGTCTACGCCTGAAAGTAGCGGCTTGATTCTATTTGGAGGCCGAATTAGTATCCAAGGAAA
AGTGACAAATTGTAGCACTGTCCGAAAGTTATGCCCCGCAAACCCCTCGGGATCATACAGTCTCGACATGACTAAAACCATTTCTACGACGGGAAAGGCG
GGGCATGTACTTGGTACGCTTCGCGCAAGATGCGGCGCCGCGAGCAGATCGAGCCAGCACTGTGCGGCGGAGGCCTTTGATTCTGCCGTATGCTTGCTGT
CCCATCTCGATCGCTTGGCTGGAAATGATATCCCTGGGGATGATGCAGACTCGGTTCAGCTCTCACGGTGTCTGTATCGATCTCTCTGTATCGACCCGAA
AGAAATGACGTTTTCGGCCTTGTACTTGCTGCTTGAAAACATAACGTCACGCTTCTTTGGATTGGATGAATTACGTGAAGACGCCAGTGCACCGCTGATA
ACCCATGTTTTGTATCCGATGCTTGTGGCTATTAAGCTCCTGAAGCTCAACTTCTTCGAGGTAATTTGATAGGCTCATTTTTGTGCTACTTTGTTTGATC
TCTTTGCGCTTACTTACTCGTTTGTGATCATTCTGTTTTTATCCAGTTTTCTCGAAGTTGCTTGGACGGATCAGAGATTGGATTACCGCCTGCAGCATCT
CAGCCTGGAGGGGTTCTTTGTTCAATTCGTGAGATTCTCTTTTCAATTGCAGATCACGTGTCAAAGTTGCCGCTCTCTGGAGAAGCGCTTTGGTTTTATC
ACGCAGTGAAACAAGAGACGGCATCGGCAATCTGCTATGGATTTTCAACTTTGTTCCCCTCTCTCATGGACAAGTTGCAGGTCATGAACCGCTTACTGGT
GAGCAAGTGCAAGTCCGAAACCGAGTTGACTCCAGCACAGAAACTATTGATTCCCATGCTTGTCCCGGGCTTCACGTCAGCAAAGATGCTTTTCCAACTC
ATGACCGACCCTGATATGCTGTTCAAAGCGGACGGTTCATCGGATGCTGTTGTTACCGAAACTGTGATAACATTCATGAGCACGCTGCTGGATGGACTCT
GGGAGCAAACGAATGACGTCGTGAAGAGTTCGTCACGAGATCCAGCTGATCTCATGAAACGCTTAGACGCTATTGAGATGCGCCATGAGTTTAAGTGCCT
CAACATCATGCTGCGCGCGACGATATTCTGGTGTTCGTGTTCCACCAGTAGAGGCTGGGTGATCATCGAATCGATCTGCACGAAGTTGGTGACTTTCGTT
TCGGAACGTCTAGACCAATGTGAGACGATGGACCTCGAGAAGAGCCATCTCCTTCCTGTCATCATCCAGCGTAGCTTCGCAGGCAAGCTGCTACCTTTTG
TACTGCTGAGCGTGTTTTCGTTACCTGCCGTTCGTGAATCATTGCCTGCTTTGATGGACCCGTTCTGGTCTCAGCTGGAAGTTCTATCATCCAAACTGCA
CTCAACACTTGCAGTTCTAAGCAAGCGTGGTGTTTTACAGCCATCGATTGTCAGCCTCGAGGCAACTGCTGCGATGGGGGACAGTTTGAACGATGCAGAC
TTTGTGGATAACGCGCTTGCATCCGTGTCTAAGGAGCTCGCGATATGTCTCCTGCAGCAGCACACCGGCCATCCCGTTGCTTATGGTCACATCTTCAAAA
GCATGTGGGAAAAAATCGTTCATTTCAAAGGATACACGTCCTGCAATGTTAAGGATGTATCACAGGACGTGGAGATTCGTCGGGTAACTATTCCCTTAGA
TCTCGCGAAGCTCTTTGGGACGGAGACATTGCTCGTGAAAGTTTCAAAGGCTGGAAGTGAGTCTGGTATGTTGGAGTATGACCCACGAAAAGTTACATTC
TCCCCTAGTCGGACTATTCTTTCACAGCACATCTATCCTTTGAGTGACGGACCTTTGCCGGTACCTGGTAAAGCTGAGATTGACGTAGGACCGCCTCCAG
CACCGCAGTCACTACTCACACAGCACGCTTCACCAAAACCACGTTGCACCGACAAAACCACTGTAAAAGGCCACGAGTGGCTCAAAGATCTGCAAAAGGT
TTTAGCCTGGATCGGAAGTCACTACGCTGCCACCTTAATTGTCGGTGGTGAATTGGATAACAACGTTGCTGTTAGTGACCGATGGTTGCATTCTCCGCTA
TTCCGGGGTGGACTAGAAGAAATGTGGACTGGGCCAGAAAATGAGAACAATCACGTTGGTCGCAATGAGGAGTTTTTGCTTCAAGTGGTGGACAACGTTG
GGAACGGCAAAAAACTCTTGGATAAAGTGCGAAATGCTGTGGATCCGGGATCGGCCCAAGGCGGTGCAAATCCGCAGCTTCGTGTTGCGAGGTTGAAGAG
GCAAGATAGCGTGGAAGCGACACTTGAGAAGAGTGGTGGGATCGAGGCAGTGGATCGTGCTGTTCGTGCGACTTTTGCAGCGCTTCTGAAGCATACCAAT
ATCTCGTACACGACTGAGCCCATTTCAAACGAAGGGGCCCTAGCTGAAACGGTTGTGGACGCCTGGAAGGCTGCGCTACAATTGCGTCGCTGGTAATTAT
CTTTTGTTGGCTGTATTTCTAACCCCCCTACCCTTTTCTAACGTGTTGGTTTTCACTTCAGGATCGTGAGAGAGCAACAGAAGTTGGCTGCAGCCTTCAG
GTAGAGAGACCCTAGATGTACGAAACTCTGATAGTACTCCCTCTAACTCACTTGTTCTTGTGTAGTGAGGTGGGAGCTCCTAGCGGATTTTCACCAGACA
TGGAAGCAAAGGAGAGACAGCAAGCACTTTATAACGCTGTATGCGAGCCTATCATTCGTAGAGCGTTGCTGCTCCTACAGTTAGCACCGGCTCCGATCCA
GACTGCTCCGTCAGCAGCATCTCCGATGAAAATCCTACCTGGAATCTCGATGGCAACAAATTACGGTGAGCTTCACTATTTTATACTATCAACCTTACGG
AACTAACCGGGCATTGCTACTGAATCACAGACTTTGCGAAGGCTGCTCAGCGCGAGCCTGCTGACACTACGTTGGAGGAGCCCGAACAGAAGCGTTTTAC
CCGACAACTAAACAAACTGATGGAGACGAAAACAATGGAAGTGATGGAAGAAGAAGACGAGCAGATCCACGCAGACATTTTCTCCTTCATTCAGCAGTCC
AGCAGTAATCTGCTTACTTCAACTCGGGATGAAGAAATGCCGAATCGACACCCAGAGGACCTCATGCGCGATATCTTGATTGTCCATCAGAAACGGGCGA
AAAAGCGCTTACAAGGGCTTAAGACGTTTGCTCGAATGCTTCAGTGCACCGAGAATATCCCGAGCTCTCGGTTCCACGTCATCCCGATGCTTTCATCTGC
ATTCAAGCGTGTTCGCATGAGTAGTGGGAAGGCAGCGGCAAACCTTCCAACAGAACAAGCTTCTATTGTCAAGATTCATTATCTCGTTGATTTGGAATTT
GCTGGACCTCAGCTATCGGATGCCATTGGGCGGGAATTTTTCCAGCTATTGACTCTCCTGCTGAAGTCATCATCGAGCCACCTTCGCCGAGTACAGCAGC
TCCTCGAAGCGGGAGTGGGTCCAGGATCTAGTGAAATGAGGTCGTCATCAACTATCATTCAGCGTGCTGTACACGACATGCTTCTTGTACTGGAAACGTG
CTGCTTACCATACAAAGGTCAAGATTGGGAACACCTGCAACGTACCAACTTGGTATCGTTGTTGACGGAGCTTACAAGTTGGAAAGGCTGGCAGAGTTTC
ATCCAATATGACGGATCGGATAGCTCATCGACAGATGTGGACAGCACTGAGACGTATGCCATACTTCCGGCTGGCACGGGATCGAAGTACCCGAACATTA
TTTGCTCGCGGTACATTACTCTTGGCACGGACCTTCGCAAACTTACGATAACTCACAAAAGTATCGACGGAAGTGACGAGAATGCGCGGGTCGCGAACGG
ACCTCAGGATTGTGGTGGGCTCGCGGTGTTTGACAAAACGTTCTACCGGGGCCGTTGGTATTGGGAAGTATCTGTACGTTCTTTTGGAGAAACTCCTGTG
TTTGTTGGTGTCACCACTGGTACAACAGACCTTAACACGTACGCTCCAGGAGATTGCAATCTCTGCGGAGTATTCCTCCACTGCGAAAATTGTACTAGCG
ACATGCTTGGATCAGCAGGGGTTCGGTGGAATCGCGCGGATGTTCTCGGTGTTTTACTAAGCTGTGAGGGGCGGCAAGTGGAGTTTTACAATAGTGGAAA
GAGATGCTATGTGGCAACGCTACCTTCAAAAGATGTGGTCGGTTGCGGTTATTATCCTTCGATCGGAGTTAAAGATGCAGATGTGCATTGGAACCTTGCG
CCTTCAGTTCCGTCAAAGCTCTGGTGTGCCAGTTCCAACTGTCAGTTCTCTAACGCAGTTGTGTCTGGGGGACTGGTTGCCGCCCCATTTGATGGAGCAA
CGGTTAGCTGGAATGGTAAGCTCAAGGGGAGTCATCTGCAACTCATGCCAAATGGAATGACGGTGGCCGCCGGTGATTGCAGCTCGTCCGATGATCAGTA
CGAGACTATTGTTGCAAGCCATGGCTTTGAAACTGAAAGCATTTTCGTTGAGGTCCGTATTGTTGCAGCTGGAAAAGATGGACGTTCGGCGCTCAGCTTT
GGCATTGTTGGCAGTGACTTCACGGAATTTGACGCTCCACTACGCGATAAACTGGATGTCAAATGGAAGACCACGGAAGAAATACTGGAGTGGGGTATAT
TCGGAGTATTATTTGATTTCGAAAAGGCAACAGTAACTGTGTACTCGGACCGCTCGGACCCTGAAGTGCATCACGTTAACCTTTCGATGATCACAAAGCC
ATTGTATCCGGCAGTGTCGGCGCTGTGCAACGGTACCGTTTACGATGTGAACTTCCATGCGCGTCCTCGTCTGGAGCTACCACCGCATGTGTTTTACCCA
GCAACAAAATTCCAGAATCATCTCATGTCTTCGTCGAACGAGCTTCAACTGGGAAAGAGCTTACAGCTACAAGTGCATTCATGCGACGGCGGGGAGTTTA
GCAGCTCCCACGCCGCTCGTAACTGTCTTCTGGACGACACAACGGTGTATAGTTCCGCAAAGGGTGCAAACGTGAATTTGGTGCTGAAGCACGAAGTTGA
CACTCCGATGTGTATCAGCTACATCAATATTCGAGGCCCTGGCCCCGGTTATTCGAGCCCACTTCGATCCGCCGTCGTATTTGTCACCAGTACCCCTCCC
GACCTAGCGGACTACCAGGAGTTTGATAACATGACGGCGGAAGAATTCGCGGCTTTGCCGTTCCCTCCATGCAATGGGTGTTGCCCTCGCGATGAAACCA
AGCCTGTTGCATTTTTCGTATTGGACGGTAGTTGCGCTCAGATTTCCAAGCAGCTGGCTTGCCCCGTGACCGGTCGATACATCATCGTTAAAGCAATTTG
TCCGTCGGCAGGCACAAATATCGACATCGGATACCTTGGGTTCTGTGGTATTTTCGACCGCGACAACGGACCAGCGTACAGTGAGAGCACAACGTCGTCC
TACAGTTGTGAGGAATGCAAGAAAATGCCGTTATGTGGGGCGTATTACGGCCAGCGCGACGATGACAGCATCAAGCTATGTGCTGCGTGTTACGACGATA
ACCGTGGTGACTTAGATTCTGCATACTACGTCTACACGTCCAGTGAATCTCAGGAGGAGCAGATGGATGGGAATACCTTACTGTGCCCGCCAAGGAGGTC
GTGGAGTGATAAGATGGCTGCCCTCAGCGATGGCTTGACCCGATCCAAACCGTCAAGTACGACGGTCGGTGACGGCAGTGGTGGTGCAGCAGTATCCGGA
CAAGCTGGTAGGACCGAAAGACTGCTTAGTGTGGCGAGCTTTGACGACTGTGAACTCTTCTCGTGCGGGCAAAATAACTACGGCGAGCTGTGCTTGGGGC
ACTGCAACTCAACGAGCAAGTTAGAGCACGTGCCTTTCTTCTCTGCGAAAGCCATTCGTGACATCGCTGGAGGGAATGAAGTTCTCGCCGTCGTGATGAA
GGACGGTGCTGTTTTCACTTGCGGACTGAACAAAAGTGGCCAGTGTGGCAATGGAACATTCGAGGAGCGAGTGATCATAGCTACGCCCGTTCGCGCATTG
AGCGGGATCGTCATTAATATGGTCGCTGCGGCGAATGGATGTGAGCACATGCTAGCTGTGGCTTCAGATGGCGCTGTTTACTCTTGGGGGTACAACGACC
GGGGACAGTTGGGACTTGGGTCGACGATTTCGAAGAGCCACACACCTCGAATGATCGATAGTCTTCGTGAGAAGTATCACATTACGACGGCCGCTGTAAG
CTACCACCACAGTGCTGTCGTTTCAAGCAATGGCGAGTTACTGATGTTTGGAATGAACGATTGCGGACAATTGGGTCTCGATCACACGCAACACCAACAC
ACCCCGCAATTGGTGGACTCCTTGTCGAGCCAAGTGATCACTGAAGTGGCGTGTGGACTCTACCATACAATTGCTATTACTAGTGGTGGAGAAGTTTACT
CGTTTGGAAAGAACGACTACGGGCAGCTGGGCTTAGGGCATGCACGGAATATGAAGGTGCCAACTCTGGTAAAGACATCGCTAGGAGAGAGTGATGAGAA
AATCGTGGCTGTAAGCTGTGGGTACTACCACACTGTGACCATCAGCGAGAAAGGCAAGCTTATCACATGGGGTCGTAATGACTACGGGCAGCTCGGGATT
GGAAGCAAGGATCACAAGAATAGTGCCCAGTACGTACCGTTACCTTTGTCATCCAAGATCAAGACTGCATCCTGTGGGTGCTACCACACTCTCATTTTGA
TGTCAAATGGACGCGTGATGGTGTTCGGACGCAACAACAAGGGCCAGCTCGGAGCGGGGTCAAGGACACTCCCATCGGCTGATCTGCCTTTGCCCGTTCC
ATCGAATTCACTGGCAAACGACGAAGTTGTTCGCATTGCAGCAGGATTTTACAGCTCCTACATTCTCACTGGGCGCTCAGGCGAGGGCTGCGGACTTGAT
GGTGCACCGGACGATGCAAGCCAGGCAAAAGACCTGCCAGAAAATAGCTGTCTTGTGAATTCAGATGCGCTGTTCGAGTCGCTGATGAAAGAGATCGACT
CCAAGCACATGACGGATGCTGCGGTGGTTAAGCGGGCCCCACTTCAGATCAAGCGCAGCTACCCCCAGCGCAAACTGCCTCTTGTGAAGTTACATGCAGC
TAGTTGGGCAATGGCCCGTGCTCTCATGTATCGGTCCCTTCAAGATGCCAGGGACAACGGCAGGAATGACTCGTCGTCTAGGCGGAACCGTGTAAACCCA
GTGCTATCCATGTTCATCAGCTTTTTGCTGGAAAGCTTGAAACTGCTGCAAGACGATGCAGCTGTGAGTGGAAGCACAAGTACAATGCTAGCTTCGACTG
CGTCTCACGAGTTGGGTACGTGCGTTTCATTGAAGCGCGTGTGTGTTGGGCTCCTACATTACTTTGGAGCCAAACTTACGCTCCCTTCACCCACTGCTGG
TGTGGTGGTGCCTCCGGACGCTCTTCATGGTCATTTCTACCGGAATCAGATCCTGAGTGTTCTACTTGCGTGTGGCTCTGCGAACACCAATGTCGGCTCC
ATCATTGCAGCTAACACGGAGGTGATGGCTCACATTATTAGTGGAATGAATTCACCCGACTTGGCATCGGCTACTGTATGCATTCGACTTGGGATGCTGG
TATTCCCCCAGCACTCAGTGTCTGCGCTTAACAAGATCCATCGATCTCAGCAGTCAGCCCCGGTGTTTTCGGGAGATATCATCAACATGCTGATGACGTT
GGTAGGACTTCCGCTTCTGCTTCGTCCGCGTCTCTGTTCGCATGAGCTCGGCTTAGAGTGCTCAAGTACAGCACTCTGCCATTCGGCTCGATGTTTGAAG
GGGGTTGCCGTGACCAAGGATATCGGAATCGCCCAGATCCAGCAGACAACCCTCGAGAAAGCTCATGTAGCGGAAGCTAAAGCGGCCGAAGTGGTGGCAC
TTTTGCGGTATCTTACCCTTTATCCGACGTGGAAGGTTGCAATCAACGCCGCGATTAACCGAGGTTTTGCGAAGTCAAACAGCGTCGGTGAGCTGCTGGA
CACGATTTGCCTTTACTACTCGAATGTTCAGAAAGCGGATGGTGAGGCACGCCAGACCGACGTTCTTGGTGGATTTAACCGAGACCCTGATTCAACTTCT
TTGAGAAAGCCCGAGTCGACTACACCTTCACCTGAAACGGACGAATCGATCAACAACGCACCAGATCTCAATGCACAAGCTGACGACACTGAGAATACCA
TCCGAGATAAACAGTCGCTAATGCTCTGGCAAAAAGCAAAGGATGCACTTGATGGGCTGGCAACAGTTGTAGCGGCAGTGAGTATTGTTGGAGGCCATGT
AGAAGGCTTCAGAGAAGGCGGATCCGTTTCGCTCGAAGACGATAGAACGCAGGGTTCGCCAAAACTAGGGGTATTATCTGGAATTTCAAGGGACCCGCGC
ACGGCTGATCTGTTGGCGCATGTTGTTGTCGAGACTAGCAATGAAGGATCGGTATCACCGCTGATCAAACCCGACGCACGCGCACAGCCAATCCCGCTCA
CAAAACTTCAGGTTGTCGAGCGCATTCCGGCTCTTGTGGATATGTTCGATGAAATTGAAAACATCATCATGACACTTTCGAGAATGTTGTCCGCATCTTC
TGCTGAAGAGGAGTGCGGTATGAACTGCGATCTGGATCTACCTCAGAACAGCGCAGTGCAGGAAGTACTTCGGAGCCGGTTGAAAATGTACAAGCAACAG
CTTCGATGGCGATCGTCCAAGGCGTTGTCCTCCTTACTGAAGCAAATCCCATCCCTAAGCCCGACGATCATGAGTATGGATTCTCAACTGGTGTCAAGCC
TAGCTTCGCTGCTGTCATCAGAGAAGTCACTGTCGTGGGCAAGCAAGTCGGATGTCTCGGGGCTTGAAACGTCAAATATTCTTCAGAAACGGTGGCTATG
TGTTAAGCAGCGACAAGTCTTCTTAAGCACAGAAAAGGTGATTGACTCAGCGTTGGATCAGTACGAAGCGGATATGCGGGACGAAGTCGTTCAGAAGTTG
GGAAGCGAAAACGCGCTAAGCTGGGGAATGGATGCGATCCAATCACCTCGGCGTAAGGTTAGCCATCCGTCATTTGCAAGTTCTGCACCTGCAGGCTTCG
GTGCAAACGGGTTGCGCGGTGCTACTCAGCGCTCCGACAGATCCGGCGAAGGAGACCTGCCGTTCGGTGCTTGGGGTGTCTTACTGCCTTTACCCCCACT
CAATGAGAACGAGCATGGCCACGCGCCTGGTGCTCCTGGGAATTCAGCAATTGACCACACACCGTTCCCACTGACGGCGCCAATAATTCGGGTCGGTCGT
GCTGCCGATGCTTGTGACCTCATTGTGAATGACCGCAGTGTTAGTGGACGTCACTTCCACTTGCGTCGTTTGCGACGAGAAGCTGACGGAACTGAGGAGC
AGTTTGAACTCCAGGATTTCAGCAAGAACGGCACGATCGTGAACGGAGTCCGGATTCATGGATCCAGCACTCGGATTACAAGCGGGTCTCGTATATCATT
AATCCTCTCTCGAGGTGGCCTGGTGACCTACGAGTTCCAAGTTCGGACGTCCGGTGGAGGCCGCCACGCACCTCCTCCTATTGTTACGACGTCGCAAAAC
CCAGACGATCTTAATATTTTGATCCCTGGGCAGGAGTACCAACAACCACAGATTGGAACACCCCAGATTGTTCCTCGGAGTCCCGCAGAGCTGCAAAATC
GCGGCTCTCCAGGAAACTTTACCCCATCGGAGAGTCTCGTTGACGGGCGAAGCCGACAGACTGTAACACAGGGTCTGCGTGTAATTACCTCTGTCGCAGA
GAGTGATGTCCCTCGAGCGTTGATATCTCCGAACCCTGCTGTGGACTCTCCTCGAGCTGGTGGGTATACCTCTCCTCGCTCTTCTGTGCTTCAAGCCCCA
GGCACCCCTTCTGTGGGACCTCCTCCAGCAAATATGTTCTCCACAATGGTACCACCAGGTATTCTGTCCCCCGCTTCATACCAGCAGCGTGAAAGTTTTG
CGCCAAACGAATCAACAGCGATAACATCACCACGGCAAGAGGGAGGCGTCGGGTCGATGCTTCGCATTGCGCTAGGCCGCGACAGCGTAAACCGCGAATC
GAGGCCAAACATCCCGAATGAACTCGCGAAGACCCGCGTGCTAAGGTCAAGCGGTGACACCGGCGTAGCCACGCGTCTGGTAAGCGTATTCTTCTGTTAG
ATGGCATACTGTCTCGTCTTGGGTGTGTTCGTGCTAACGATTATTTTTTGTCGTGTAAACTTGCATTATGAACTATGTCTAGAACACGGCGTCTGGCTTC
CAGGAAATGCAAGTGCTAACTCTTCGTCTTCTTGCTCGAGTTCAAGAAGCGAATATAGCAGCCAGCGCTACCGAGTGCGAGGAGGCCCTCCGCATGACGG
CTGGTAGTATGGACGAAGCGTTTTCGGTAATCCAACGTAGTCGTGGTTCAGACTCGGTAAGCGTTCCTAACTATTGCATCATCATCTACACATACATGTA
AGGATCTAACACTAACCGTTGCAGCTTTCTGGTGATTCGCAGCGTGTCTACCCTTCAAATGTGCGTCACTTAGCCACGGTGCTAGGAAGAACCGAGCCAG
TGTGTGCGGAAGCTCTTCGTCAAACCGATAACAAGTATGGCGATGCATTGCGCTTGCTGCTGTCAGCTAGAGGTGCAGAGCTTGAGAGTTCAGTGCTTTC
ACCCAGGCACCAAGATACTCTCACCACAAAGGGGGGTAGTATGACGCCTTCTGGAGTTAATGGACCAGTAGCGAGTGAGCCGTTGGTTAACTTCCAAGAC
ATTGGCGACGAAAACCCAAGTTACGCTCTGACAGAATCGAGCGCATTGTGTCCCCCTGTGCCTCAACGGATCGGCACCAGAGGAAACGGAAGTCCGGTAA
AAACCAAGAAAATGGAAAGCCTCGGTACGACGTGCTTGGAATATCTGCCGGCGAAGACGGACCTCACGCTCTGGAGTGAGTGCAACAGCAGCTTCGATGA
CGGCGTTCGACAGATGAATTCGTTTGAGATCGACCTAGAGGAAGAGACGCTATGCGAGCGTCTCGCCGCAATTCACGCACGCAAGATCCTGCTTCAAATT
GTGAGGCTATTCCAAAGCGCATCACAAAATGGGGACGTCCAACTGAGCGAACTCGGCAATCCAGTGGTGCTTCGGCGGCTAATTTCGCTCTTGAATGCGC
CCAGTCAGAGCAATACGAGCACTGCATGCGAGCAAGAGTACCAGCTACATCAGCAGCCGAAGGCACAAAAGAGTGGAAAGGTCCAACAGATCCTCTCGCG
CATGGCACGTGAGGTGATGGCGCGCTCTCCCACGCAAACGTTAGCTGGGAACCTGAGCTCATCCCAAAATCTATCGACGCTGCAGCGATCAATCGATCAA
ATGACGGAGCACCCAACGAAAGTTGGCTGGTCAGGCATGAGTCGACTTGTTGAGGCTCTTGTCAAGAGCGACCAGAACAGAGTCAACGCCGGAGAGGATA
TTAACGACCAAAGGCTCTCTTGCACACTGGAGAGCATCACATTCGAGACGATCCTGCACATTCTTTCTCGTACGCATGCAGCTCCCGTTACGAACTTAAA
CTGGGATAGCTCTCCCCTTCGAGTCCGCAAGACTGATGGATGTTTCCCCAAGGGACCGATGTTGCTCTCGTGTGGTCTTGAAGTCTTGGTAGTTGATACA
TACGAACGCTTATGGAGCATCCCACCACCGGATCCGCTACTCAAGCATCGGCACAAGTGGCGGAAGCGGTTTGCATCGTCCGTGGGCAATGATAATGCAT
GGATGAAGTCAGCGGCAGATCATGCGGTGACAGTTTGGCGGCCAACATTGCCAGCAGCGCTCGAGTCTGCAACGCCCGGGGCTAACAAGTGGTATTGCCT
GGGTGACGTTGTAAAGTGTGGCAATGGAGCCCCGGATGCGCCTATGCTCCTTTTCAGCGACTCCGAGGAGCAAGGGCTTTTACTGCCACCTGTGAGTTTT
GAACGGGTCGACGTTACCGGCAAAGGCTTGCCCCGGAATTCCGAAAGTGATCCGGACTTCCAGCGCAAGCAACTACGCTCGATATGGTGGCCTGTTGCAC
CGCCCGGGTATGTGGCATTGGGCTGTATTACTGGGAGCAAGGAAGACCCCTTTGAACCTCCTGACGTTTCTAGCACGCGCTGCGTACGGGAAGATCTCGT
CAAGCCTGTTGACGCGTTTCATTGTGTGTGGCGCGCAGCTTCACCTGCCTCGACAGGGGGTGGAGGTGTCGAGCTTCCAACAACGATCGAGGTTGAGAAC
GAAGCTCAGGATGAAGAGAATGCGGGTGGCGAGAACGACAACTCTGGCCAGGCTCGTGGTACTAAGAACCAGTCTATTGACACGTCTCGGATGCAACTAC
TGCTGCCAGTCGCCAACGATGTAGTCGTGCAGACTTCTCTTTGGGCCGTCGAATCTGACTTCAGCAGCGGACTGCTGTTGCCTGTTGTCACACTGAACGA
CGAAAACGCTGGCGAGCCTAGTACTGCATTTGCGCTAAGTCTCTCGGACGAAGATCTGGTTCTGTGCGCACCAGTTAGTGTTGACAATGTGCTCGCCTTC
GTCGAAGTTTTGCTGAAGTACCACAAGCTGTTGCCGAGTATTCCCCAAGACAAACCGACACCACCAACACAGTTGCGTTCCGAGCTGCCGGCAGCACTAT
TCGCGCTGGTGCAGCAGGTATTACGCGAAAATCAACCGTCAAGTGGCCAGGCTGCCGTCTCGCTTGTACGATCACTTATTACGGTGATTCAGCGAGGTGG
GCACTGGTATGACAAGCAAGCCCTTCTGTACTGCCGGTCCAAGATCATGGCTCTGAGTCAGGACCAGGATGGCGGCTTCACATTGCATGCCCTTCTACAG
GCTTTTGTGGAGTTAATGCTGGCGGTGGAAGATCAACAACGCGCGCAGCGTGTACAAGAGCTTGCAGCTTGTCTAGAACGTGATGGCGGCAACTCGCTGA
GCCTCCCGTATGGATTCCACTTTGCGAAGCAACCGTTCGTGGAGATGCTGGTGAGTCATTCGTCAAAGATGGCAGTCACTCGGCACCTGTCGGGAGAAGA
GCGTAAGTTCTTGCTGGACTTCCGTGCTGACGATGGGAGCAATGCAGCAGCCAGGGAAGCACTGGCAGCTGAGGGACTTGGAGCGCCGCCTGGAGACGTG
TATTCTTGCCGATTGGAACACACGCCAGCTCTGGTGATGACCATGCAGGATGAAGTGAAGGCTGAAATCGTGTATTTTGAAGTCACTGTCGTGGAGTGGA
GCACCAGTGCGAACATGGGTGGCTCACTTGCTGTGGGATTCTCGCCGCCTTCTTTTCCTCTGGAAGGAGTATTGGTGGGCGGAAGCGCTGATGGCTCACG
GTCTTACTCTTTCACGCCGGCTAGTGGGCAAGTTCTATCTGCTGGAGATACCAGCGTAGATCGCTGGCGTTGGGTAGAACCGGCTGGTGCAGTGAGCCCT
GGTGACGTGTTTGGCTGTGGCTTACGCCTGGACACGCAAGAAATTTTCTTCTGCAAGAATGGCCAGCTACTAGGCACAGCCTTCTCAAGCATTTCACGTC
CTCAGCAGCTTCACCCCACTATTTCCTTTAACGCCGATTGCAAGCTACTGGCTAACATGGGAGCTACAGCGACTGCGTCAGCGAAGAACGCCAACTTCAG
CTTCCGTTTCCACTCTTTGGATTGCGACAACCTTATGAGTGCCTTCGAGTGGTTCGAACCACTAAGCCAGGTTTACGGTGTGATGAAGGCACTCATGGAT
CCGGCCAGACCTAGCGAAGTGACAGGAACGGAGGAGGTTCCTGAAAACAATGAAGCTGTGGCTCAACTTCCGGATGAGTTTATGCTCTCTGCCGACAACT
TTTTGTCGGACATATCGGAGGATGTATGCATTCGCGTGGAGAGTGCGCATCCTTACGACTTGGAACTACAAGAATCTCTTGTCAGTATTCCTCTGGCAAC
CAGTATTCGTGTCAGGCTTGCTCCTCAGAGCGAAACGGCCAGTTCCCACTGCCTCCAGATTTTGCAAGGAGGGGGTAATGCCGGAGGTGAAGGTGGGGCC
GAAGAGACGACAAGCGGCGGAGGCGAAGCTGAAGTGCGTGCTTTCACGGGCTCTTGTGGAGGCCAGGAGGTCACCATTGATGGTGACAGTTTCGTGTGGC
GATTCCCTGTGCAGTCCAACTTCCAATGCCGAGTGGACCGCGTGCGCAAAGGTCCATATCTGAAGCTTGAAGCTCGAGACACAAGACTGTCACTTGTGCG
CGACAAGGGCTGGCAAACTGCAATTGGCGTGGCGCGTTTCGATGGCGGGGTGCATATCTGGGAGGTCCGGATTACCTTTGTGACCGCGAGTTCGAACATC
TTCCTGGGTATCGCTCGTAAGGATGTGCGTCTCGACTCCTACCTTGGAAAAGATAACCGCGGGTGGGGCTGGATCGGCAACCGTGCGCTTTGGCATAATG
GCAGTAAACAACGAGGTACCTACGGTGACAAGTTTAAGACGGGGGATGTTGTCCGACTCACGCTGGACTTGCGGCGTGGAACTCTTAGCTATGCTCTCAA
CGGGAAGGATTTGGGCGTCGCTTTTGGTCCTGGAGGAACCGGTCCCAAACTCGAAGGCACGTTCTACCCTGGGTTTGCTTTGTATAACCAACGCGACTCC
ATTGATCTCATCGGTGGCCACCGCGTCGAAGATGGAGGTCTTGAACCTGGCTTACCCCGGACCGGAAGCGGACTCGCAAGTGGAGAGGACTCGTACTACA
GTGAAGAAGAAGAAGATCTGGGAGGGTTTGTAAGCGGCGAGGGGGGTGTAGGTGATGGAGCTATCCCGAACTTCCGGATGGAGTTGGGTATCGCGCTAAG
TCAGATGGGCTTCCCAATGGACTGGTGTATCTACGCCCTACGCCACTGTGAGGATGATGCTGAGCAGGCGGCAGACTTCATCTTAGCCAACATGCATGCA
ATGGAAGCACTCGTTCGGGAAGAAGCCGAAGCAGTCGCGCGCCGCGCCCGCCATCGTCAGATTTTGCAAGAACAAGCACTAGCTCTGTCCGAGAATTTGG
ACGGCGATGTGTCAGATGCGACTTCCATCCCTCCACCACCACCCATTGATGGAGATGTTGATGCCGTTCGAGCCGCAGAAGAAGTCCCTATCGGTGACAC
AACAGAGCTTCAGCAGCAACAGCAACAGTCGTCTGGGGACACCAAATGGGGTGTAGCGTTTACAGTCGTTCCGGAATTCTCAGTTACCGGACGTCGTTTA
TTGGCGACCAAGTACAGCTCCAAACTGCGCCGCTTGCACGCATCACAACGAGTATTTACTCCAGCACGCGACTGTGCTCTCGTGCAGCTCGTGAACGAGA
TATGCGAGTCTCGTGCCGAAGCTCTTCTCAGCTGTGATCCTCTCCGCATGGCGCCGGAGGAGTTTGCCCCCACAGAGGAGCAGCTCCGAGCCTTCCCCGC
TCTGCGGGGTATTCCTTTGGAAGCACTTCAGCGCCGCTTTTTGGTGCTCCGTAACTTTAACTGTCGTCTGCAGACTTCGCTAGCCTTCATTGATTTCTCG
GCTCAAGACGAACGGTCGTTGTTAGCACGAGGCGCACGCGCTCTCCGCGGCGTGGTGTTCCAGCATGTGAAGCTTGCATGGTGGCTTGGTGTTCTTAAAG
AGCAACAAGCACCGGCAGCAGCTCGTCCAGAAATCGAGGTTGACCGTCATCGTGCGCATGACGCCTTAGAACTCTCGGAACATGGTGATCCCCTCGCTAG
CGAAGCTGGTGAGCGTGACAGTGTGTTTGCGCAGACGTTTGAGCAGCTGCATGGCCTTCAGCCTACTCTACTACGTGGAGCTGATCGCGCTTTCAAGTGC
CAGTTTGTAGGCGAGTTCGGTGACGATTTCGGTGGTTTGTACCGCGAATGCCTAGCTCAATTGAGCTCCGAATTGCAGACCTTCACGCCACTACTGCCGG
TGTTGCGACCATGCCCCAACGCTCTGATGAGTACAGGCGAAAATCGCGAGCTGTTTGTTCCGAATTCACACCTTCGTTCAAACCCACGACGAGTGCAAAT
GGCCGAGTTTCTCGGAAAACTTGCTGGTATAGCGGTGCGTACCAAGACGCCTTTGGATCTGAACCTTCCTCCAGTTGTGTGGAAGCTTTTGGTGGGGCAG
CAGGTGGCACGCCACGATATTGAGGTCATTCATCAGGGCTGCTTCCAAGTGGTGGATACGATAGCTAACCTGGCCGCTCACGGTATTACCGAGGCCATGT
TCGATGAGATCGTGGACGCAAGCTTTACAGTACTGTCGAGCACTCGCGAGACAGTAGAGCTTGTTCCAGGGGGAACACACTTGCATGTGACTTGGGATGA
TCGCGAGGAGTATGCGTGTGCAGTCGAAACATACCGGCTAACTGAGTTTGCACCAGTGTGCGCGGATATGTCACGCGGATTGGCAACAATTCTTCCAGCC
CCTACACTGGGACTTTTCTCGTGGCATGAGTTGCGGACGCTTGTGTGTGGAAAGCCGTCCGTCGATATTGCTCTGCTACGACGACGAACCATATACGGTG
ACGGCTGTCAAGCAACCGACCCGCACATTGCCTACTTCTGGGACGTTCTGGGCGAGTTCAGTGACGAGCAGAAGTCTTCTTTCCTGCGATTCGTCTGGTA
AGGAATCTTCGTAGGCGTTGCATTTGGTATGATCGAGTGGATTCTAACAGGGTTGGACTGTGTTGTGTTACAGGGGGCGATCGCGTTTGCCGACGCATGC
TGCAGACTTCACACAAGACTTCAAAATATCAGGGTTGCCCAAGGCTGCAGGACGTGCCGACATGTACCTGCCTATTGCTCATACCTGTAAGTGTCGCAAT
GCTTCATCACGCGGCTACTTTCTACCTTCAGAACTGACAGAGATTGAATGCTCCACAGGTTTCTTTTCCATCGACCTGCCAGCCTACTCGTGCCGTGAAG
TGATGCATGACAAGCTCGTGTATGCCATAACCCACTGCCAGTCTATCGACGCCGACAACACGACCGTCGCTCAACGAGCTGGCCAGGGCATCAACTGGAC
CAATGCTGCCGCGACGGCAACGGCAACCGCGACCGCCGCAGTTTCCAGCGTTATAGCAGGAATGGCAACCATAGTCGGCGAGTGAGCAAGCCATCCATAG
TGGAATTATATATGCATATTTCATGTTCACACGATTGAATGAATTATCGCCAAGTTTCAATGAATCAACATGGTTATCAAGAGCACTTCTTCTAAGCTCC
CTTACAGCGCGTGATTCGAGCAGGTACCGATCGTTCAAAGGCGCGGCCCCAGTCGCCATGGTTGGCGACCTCGTTCAGCGCGATGATGACAGAGTCGAGG
TTCATGATGTGCGTTCGAACCCTCGCACCAGATCGAGCAAAGTGCTCTTGAAGCGGAAGTCGAGCCGTTCGAACGCCACGCTCAGTCGCCTTCGTCATGG
TCTGACCCTGAAAGGCAGGTACCATTTAGCAAAAACTAAGCTTTTGTGAACGAGACAGTTGTAACTTTTGTACCTTGCGAACAGAGCGGTCGACGATGCC
ACCAACGACGTAGACGCAAGCTGGATCAAGGGTCTCGAGTACGTTGTCTGAATCTGGCGATAAGTAGACAATCTCGTCAGCGTCGTACAGTTCTTCCAGC
GGTTCTTCATGCCTTCCAATCTGTCCGTACACCCAGCATGCAGTAAGCAACAGCATCCAGCAGCAATAGTAGAAATGGTCGTACCTTCCAGCTAAGTGCG
CCATGCTGGGCGCACACAGCAGCAAGCTCTTGCGCACAGGATGCGAGATGCAGCGACACGAGGTTATCCAGCGGACAGCTTTTCAGGTATCCGAAAACAC
ACCCGAGCTGCTTCAGGATGCTATTGCGCTCCTGCAAAACAAGCAAACGACTGCACCATAAGCACTTATAGCACTCCACAAATACACCCATCTCCAAGCA
TTCGTACTCGACTTGTCTGATCCACTGCAAATGCCAAGTCCACCACGACGCGAACCCCACGCAACTGAGCCTCCTCCAGCTTTTGCTGCACACACCACGA
CCAACACTTAGTACATTCATAACCGCAACTCAATCGCCCCTATTGTAGCAGTCCTTACGTATTGCTCCACTCGTTGCATGCGGATCCGCTCTCGCAGCTC
AGTTTTCTGCTCCTCGGTCATCTCGGCCCGTTCGGCAGCTAACGCTTGGCTTTTTGCGAGCTTCTTGGCCTGAAGTCGTTGGTCCTTATGATTGCGACGC
TTGGACCGCATCATCTCGCGCCGACATTGCTTGCTAGTTTTCTCGCACGCTTTAAACTCTCCGTCACGCTGGCAATGTCCATACAATCCCAGTGCACAAC
ACACCGCGAAGGCAACGAATCCAAGAGCCACAGCCGACGGTCTCATCTTGACCAAAGATAGGAATAAGTTGCTCTTGTCACAAGTCGCACGTTTGAGTCG
CCCGTGATTGGCCAGCTCAAATTTAATCTGTCGTTTCATTGGCGGAAAAAGCTGCTGGTCCTAGAGCCAACAGCTCAATTAGCGATGGCGAACAAGAGGC
GGCGGCGCGCCGAGAGCTTCCAGGTCGAGCAGGGCGGCGAGGATGACGCCCGCAAGCGGCTGGAAGCCTTCCACGCGCGGATGTTCGAGCTGCCGCAGGA
GGAGGCAGCAGTCGCGGCCCCGGAGGCCACTCGCGTGACCTTCAAGGCGAAGAAGAAGCACAAGAAGCACAAGGGCATGGGCGGAGACGAGGACGACGGA
GAGCCTGTGCCCATGGTCAAGTTCAACGCGAAGCCCAAGAAGGAGAAGGAGAAAAAGACGAAGAAGAATTCGGCTGAGCCCGTGCAGGTGAAGAAGGAGA
AGAAGAAGAAGAATGCGGGCCCCGCAGTCATCAAGGTGCCAGGGATGCCGACCGTCGTCAAAAGTGAAGCGGTCAAGACGAAAGTGGCCACGCATGTGGT
GAAGGATAATAAGAAAACGAAGAAGCAGCTGATCACGACAGTGCAGACGGTGAAGAAGACGACAAAGGTGCAGGTCGCGGCTCAGGCGCCTCAGTGGCAT
TCCATGCAGAGTGGAGATGCTCAGGACGACGATGAGGGCGTGGACCCGTTGGAACAGGCGCTCGGGAGCATGAAGGAGATGGCGAAGAAGCAAGCGACGA
AGCCGCCTCGCAAGAAACAGAAGAGCGCGACTGGCAAAGCGGTTGCTGCGCAGAAGACGGAAAAACAAAAGATTGCTGAACCTACTGAGCCTAAGACTGT
GGAGAACCAAAAGGATGCTGAACCTGCTAAGTCGAAGACAGTTGAGCCGAGCCAGTCACCAAACCAATTACAGAAAGCTGAAGTGAATGGTAACGTGGAT
AATCATCCTGCTGGCACTCTATCGAGGAGTCAGAAGAGGAGTATGAAGAAAAAGCTAAGGAAACTGAAGCGCGCTCCAGTGAAGGCCAACGATGAAAACA
CTGCGTCCGCAACGCCGCCACAACCATTAGAAAAAGCCGACGCTTCTTCCTCTGCTGGAGCCAAGCCGTCAACCATCGTGAATGGCTCTGCCCCCAGTCA
ACCTGTTGCACCAGCACCAAAGTCGCCAGGCTCACGCAAGAAGCGAAAAAAATCTCCCAAGGTGAATGGTATGAACAGTGCGTCGCCGAAGACCGTCGTT
GCTGCAAAGCCAAGACAAGGGAAACCGCTCGTGTTATCGGACGAGCGCCATAGTGAAGTTGCTAGCAACGCTAAATCAACTGCGCTAGGGAAGAAGGCGA
AGATCATGTCATCACCACAAAAGAGCAAAGCAGTCACCCAAGGTGCAGCTTCGTCTGTGAAGAAGAATTTGGCGAAGGACGAGGCAAAGGATACAAAACC
TACCAAGCCTTTGACGCCGATTGCAGCATCTCTTGCCAAGGATGCAAAGAAGAAGAACGACATGTTCTTGCCAGCTCGAGAGGAATCGGCTAAGACCTTA
GTCGCTCCCAAACGGGTAGTAAAGGCGGTGGCGCCTTTTGTTGTTCCGCTAACGCACGACTCATCTGAAAGCGAGGAGGATAGTGGTGTTGATTCTGATC
ACAGCGACGACGCATCGCTGTACTCGCGTCTTATTGATTCGGCTGCTCGAGAACGTTGGGAGCTCGTGGAGGTTGGGCGGCTTGTTCGATTATTTGCTGC
TGAGTGGAAGTTCAAAGAGAGCAAAACCGCGCACTTCCTTCTCGACACGTGCCCCGAACTTGTAAGTGTGGACTTCCTTGAAGGACTGGGTATCAACTTG
TCCGCGAAGCACCTGATGCAAGTCTTCGAGGCTGGATCTGGCAACTCCGGAGTGCTGATGAACAAAATGGCGTCGGCCTTAGAGAACGGACACTTGAGTG
TGCGTGACCCGGCATTTGTCTCCGCCTTGGAGCGTCGGGTGGCCCTGATGGAGTCGAATACTGAAGTGATGGAGCTGCTGCATCCGCTTATGGAAAGCAT
GTCGACGGTGTGCGACGTCGGTTGCTTGTTGAAGCAATTGTGTGAGCACTGGCAGCTTGAGCGTAAAATTGCGTTGGTTCAGCAAGTCTTGCTGTCACAT
ATTTTTGACGACCTCGATGGAAATCAAGATGAAATCTTGCTCGACCTACCTGATCTGACAGATCGGCTGGATTTCCCTAGTCGTTTAGACCAGGAAGACG
TCGATGAAAACGGCAACTTGAAGGGCTTCCTCGCGCATGACGACAGCGAATTCAGTGAAGTGGAAGGATCAGAAGAAGACCTGGACGAAGATGATAGCGA
GGATGATGATGCGGACCCTTACGAGGGTGAGACCGATTCGGAGGAAGAGGATGAGATTACTGGTCGTTCTCGGGGAAGGAATCAGTTTATTGAAGATGAA
GCTGATGTTGGAGAAGAGGATGAAGAGGAGGAACAGGAGTGCCACGATGACGATGAATCGTCTTCATCGGATGTATGCGACTAATTTCAAATAGAACAGC
ACACTGCTCGAACCCTTGGCTTTGCGTAGCAATTTACATCGATCTAGGAGGCAGAAACTTGGTTGGGTGATTCTCGACAGGGCTCCAAGATTACGTCTTA
GCTTGCGCTTCAACTGTAAAACTACGTCGAAAACATGGCATTCAAGACAGCAAGAACAGCAAAAATCAGGGCAACCCACATGTACGGAGCCATGCCGCTG
CTTTCCTTGTTGTTCTTGGAGATCTTCTTCTTCGAGTGAGCGATAGCGGCTGCACAGTTTTAATGTTGGCGATACATGATTAGCTTCCATACATACATAC
ACAACGGCCTCAAGTTTACTACTGAAGTGTCACGTACCGGCTCGAGCAGCAGCAGTGTTCTCTTGAAACTGCTCCTCGTCATCACCCTTGCCTCGGCGCC
CGCTCTTCTTCGACGACTTGGCTGGCGACTTATCTTCCACCGGCTCCTCGGCATCAATATCTTGCTCAAACGTTTGCTGGGCAGTTAGCCCATTGTTGTT
CACTTCAGCAATCAAATCCGGGAATGCAGTGGTCAGCGTCTCCGCAGCTGCACTCGGCCAATTTCCAGACGAATCGCAGTGCATCGCTTCCGAATGCAAG
GGCGTGTTTCCGTGGGCGTTCTTAAGGGGTTTGGCGCCCTTCATACACAGCAATGCGACGATTAGCCCCGATGTCTCCAGCGGCTTTCGTTGCAATACGA
ACCTTGGAGATGAGGTAGCTGATCAACTCAAGTTGACCGTCTCCGTTCTTGATACACGCCCAATGCCTACATCGGATCAGCATTTCCACCCAAAGTATTA
GCACCAACTCCAGCACCGTCATCGTGGTCACAGGTCCACCTACAGTGGAGTGTTTCCCTTGGCGTCCACCACGTTGGCGTTAGCACGGCCCGTTTCAACC
AGCAACTGGACGATCTCGAGGTTCCCCTTGGCAACCGCCACATGGAGTGCCGTCATCTTCTTGTTGTCGACTGCATCCACCTTAGCCTTCGCCCTCAGCA
GCAGCTTCAATGAGTCCACCTCCTCGTACTCTATAGGTGCAGCACACCACAAACAAACGCACTTCAGTAAATACGAGTCACCATAGGTCTGTTTGCATAA
GCCAAAGGATCATTGCTGTACCCGCCGCTAGATGAAGCACCGTTTGTCCCGAAGAGTCCTGCAGACTGAGGTCAGGCTTGCCCTTGAGCAGCGCCTGGAA
GATTTCCTCAAAGCTCGGCGGCTGTTGAGCCAGCGCCAACATCAGCGGCGTGAAGCGGCGCTTCTTCTCCTGCAGGTTGAGCATGGCCCCATTGGACACG
AGGTGCTGCACGATCTCCAGTCGGTCTTCAGCCACCGCCACGTGCAGCACTAACGAAGTAACACAAAAATGACGAACAGTTGTTACTTAACATGCCCCTA
TCACAGCAGCTTAGATAAAAGTCACATTTGTTGCAGTCGTACCGGACTCGCCCTTCTTGTTCTGGAAGCCCCAGTCGCTGCGCAGCTCGATCACCTTCTC
GAGGTTTCCATTTGCTGAAATGTAGCCATACAGATGTGTTAGCTGCAGTAGTAGGGGGTGAGCGTCGGAGCCGTGAGCACGCGCGCACCTGCAGCGCGGA
GCAGTTGAGCCATGACGTGCGTGTCTTGATGATCGCTTCAGTCGAAGGGGGAGTGAACGTGGAATCGTGATATTCGAGATTTATCGACCAATAGTAGGTC
TGGAAAAGATCGCACGAAATCTGAAATTTGATGTTGTAGAATGAAAACTCAATTGAAATTCGGGTTGTGGACTTGAATTGGACACTGGTCGAACTGCTGC
CGATAAATTAGACGTGGATAGATTGTTGCTGGACTTCAATGACTCGTATCAAGCTACAGCTGAAATTTCTGCTCATGGTGGACTGTTTCCTGCTCTTCAG
AAGCCCACAAGACCGAGGCGGGGAAGGAGGCGGCGGCAAGTGAAGAGTTGGAGGGAGTTAGGTGGGGAGACGGGAATTTCGGAGGCAGCGACGCGGTCAT
TCCGACGGGCGTGGACGAGCTTCCTGGTGCAGCAGAGGAAGTAGGCGGGATATGGACCACCGGGGCCAGGACGTGGGTGCTGCTAGCAACCGGCGTCACT
TTTGACTCAATGTTGAGTTTCATGCTGGACACGGCGGGTGCCATGCGGGCGTCACGCTCCACCTCGTGGAACATTTCCTCCGTACTCGCCAAGATCTGCA
GCAGGCTCGGGTAGTTGGAGAACGACGACAGATTCACCTTCCGGCGCATGTACTTGGACCGCGTGTTGTAACCCGTCATCTTGTCGTGCTTCTTGAGGAT
CTGAGGTGCATCAGCAGTTAGAGAACGGTTGGTGTTGCCCGGCTTCACTAGAGGAGAGAACCCACCTTCGAAAAGCCCTGATAGTTCATAACGGCGAAGT
TCTCGAGACGAATGCACTCACGGTAGAAGTGGACGAAGGCGAACATGAGTCGCTGAGCCTCAGATGCCTCAATCTTCTCTCGTTTCTGGAAGAGCAACGT
CATCACAACAATCAGAAGCGCTCTATAGGGACAACCAGTCTGTTCGGCCACGCACCTTGAGCGTCTTAAGGACAGAACGCAGCTGCTGGTAGCGGAAGGC
GACGCGCTTCTCCTCGGCAGCGTAGAAGAGCGAAATCTTCTTGAGTTCTGCCTGCAGGTCGCGGAAGAACGCTACCTCCAGTTCGGATTCGGCTGCAATA
GGTTCAAGCTGGGTCAATACTTACGTACGAGGTTGAAAGGGGACGAACATTCACTTTCACGTACAGATGTCGCGCTGATTGACGGCGTGGTGCGCTGCTC
GGGTTACGGCTTTAATGCGCTTCTTGAGTATTTTGTAGTTGAGCCAAAAGGGGGCCCACTCCGGGTTGCTCTGCAGAATTTCCTGCAGCAAGCCTTTGCC
GAACTTCATGGCGACTGAATTGACGAGGTGGTGGGGGATTCCGAGGGTTGAGGGGTTTATCTAGCCCTCACCTGAGCGATTGGGAAGTGATGAGTGCCGC
CGTGTTTGCAGAGATTCCGGAAGCCTCGATGCATTAGGAGAAAAGCTGTGCTTGGGGCCCAGAAGCCGTCACACTCGATCTTCCGCCTTCAAGGTGCGAT
GAATCTCGGAGATTC