Description :
From Genome Similarity Track
Location :
Scaffold_95:58703- 63617
Sequence
4914 bases(100 bases per row)
TACAAGGGAGCCGATGAAGACTCTCTATTGAGATGGTTCGTGAAACTAGACGATGCCATAAAGGCTCGTCATATCGTCGATGAGGAAATGCAGATCGCAT
TTGCTCAATCGAACTTTTCAGAGCGTGCAAAGACGTGGGCCCTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTTAAATCCCT
GCTAAGGCAAACTTTTGAGCCGCCTCAAGCGGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATAAATCAAGGTAAATGTGACGTACACTCGTACATTCAG
TACATACGTCACCTTACCAGTTGCATAACAGTCGACCCCCTGAACCAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAA
CCTACCTGTTTCGATTGGAGTTCAACACCCTAGAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCATGAAACAGGCTCACGTGAATTCGAATTC
CTATCGTCCATCGAGATGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTAAAGGGAGGAGCGAGAGCTCTCGTGTTAACAATTACAAAAAATTG
CAAAAATGCAATAGATGTCAAAAGACCCCTGTCTTTTGACATCTATAGGGCATATGCATATGAGTGCAGTGCCCCGGGAGCGGTACCACGTACCGCAGGA
AACAGTAACCGTCAAGCGGCCAAGCGAGGTCCAAGGCGTGGGTCCGACGTTGTTGCGAAAACGCAACAACGTAACGGACAGCAAAAAAACGGTCAGGGTC
AGTAGGTGCGGAGCACCCTACTGATCCAGAAACGTCAAGTGAGTTTGTAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTGTGTGTTTCTGCT
TCTGGTAATGAGGTTTACCTCATTACCTTGAAACTCGAAGTGACACAAGGCATGTCGCTTCGAGCTCTAGTCGATTGTGGGGCGTCGAACAATATTGTAC
GACGCCAATCGCTAGACAAAAGAGAGCTCGAATATGTTGAGCGAGAGATCCCTCCAACGAGGATGACGGTGTGCCTCGCGACAGGCGCATCCGTAACAGT
GATGAAATGTGTAGTGGGTATTACCTATACACTGAAGGGAGTCCAATACAATGATGACTTCATCATATTAGACTTGGATGACAAATTTGATGTCATCCTT
GGACTGCCGTGGCTCAGAAGGTACGAGCCACAAGTCAGCTGGCATCGACGAACAGTCGATATGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACG
CCATGGAGCTCCCAGTAACATGTGGGTGTACTACAAGCGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTAAGACTGCACATGGCCATCGAGTGGC
TGATCGCCACACCATGAAGTCAGATTACGGCGACTGCGTTGAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTATGGCATGGG
TGACCTCCAAACGGTCAACACCCAAGTGACAACGAACCGATTGCCAAATGATTTGCAATAGGATGATCTTAGTGCGATTGGAGAATCGCACGTAAAAGAC
CTGGCCGTGGTAGCGCAACCACCGCCAGAGGATAACGAGGGATCAATTCCAATCGTGTCATATAATGATATAGCCCAAGAGGCTAGTGATGGAATAAGTC
CCCACCCAACTGTGGAAATGAGTTCCCAGGAGACAACAGAGACATTAAATATCCTAGTCAATGACGGATCAAGAACAGGAACATGCCAACTTGATTTGAT
CGTGCCTCCGAAGACAACTTCGGAGATCGTTCAATTGCCCACGCTCGCACAGAAAAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGC
GTACTCGTCGCGGAAGACGAGTACGTAACCGATATTCGGTCGGCAATGGTATTCGCTGAGAACGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTG
TCCTTGATGAGAAGACTCGGATTGATCGATATACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGACGGAATTCAAGGATGT
GTTACCAGAAACAGTGCCGTGCGAGCTACCCAAGGATAAGGGTACTCGTCACGAGATGGACCTGAAACCAGGGTCAAAGTACTGTGTCATGAAGCAATGG
CCATTGCCTCGTGAACAAGTACTAGCGATTGACAAAATCTTTGCCGATCGCTTGGTAGCGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGA
CCTTCTGTGTGCGAAAGGTCACAAGAGGATGGCGGATAGTACATGCCTTCAACGAGTTGAATGCTGCCACTGTACCGCCTCAAACGCCGATACCAAGAAA
GGATGTCATTATAGATGGTATGTCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGATCCTAATGAGCGAAAATTACATTCCT
TATACAGCAGTAAGCACCCCAAGTGGTATACTTTGGGAGTGTCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAACAGGTGTGTTATGA
ATCTGTTGAGATCTGTGCGAGAATTCGCACCCAGCTATTTTGATGACGTGTTCGTCCATAGCCGGGCTATGGATGCACAGACGGATTTGGAAGTCCACCG
ACTCCACGTCCGGAAAGTTCTTACACTGATGCGTGAGCATAAGTTGTGTGTCAATCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGA
TGCATCGTGGGTAAGCACGGCGTCCGGCCAGATCCGGAAAAGATCAAGGCGATCACTGACTTGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCC
TTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTTGCCGTGGAG
TGCTAATTGCCAGCGCTCCTTCGAAGGTATCAAGCAAAGCTTGATACGCTCGCCAGTTTTGGCAATTGCAGACCAATACAGACCATTTCATGTGGTCTGC
GATGCAAGTGATTTTGCCATCGGATGTGCACTAATGCAGTACGACACAGAAGGTGCTGAGCGTATCGTCTGCTATCAGTCACGTCAGCTGCAACCAGCTG
AACGCAACTACCCAGTCTATGACAAGGAACTCTTTGTCATGAAGTATGCTTTGGAAAAATTCAGGGTCTACCTACTAGGTGATAGACCTTTCATCGTATA
CACGGACCATGCGTCCTTACGCACGGCCGTTAACAGTCCACACCTCTCGCAACGAATGGCGAGGTGGTTGTCGTTCTTCGCGGAGTATAACTTCTCCGTG
GAATATAAACCAGGACGACTGAATGTCGTTGCTGATGCTCTATCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGGTTCGACCACTGTCA
CGGTGTTGACATCGAGTGTCCCGTCGTCAACCATTATTCGAAGACATACGCAAGGCGTACGATCCGGCGATGGTGCGTTTGATGGATCATCTCTCTCAAC
CATATCGTCAATCCCTTATAATGTTGCCCCCAGTATATCGATCCTCCACGGATAGATATACAGTCCAAAATGGCTTACTGAAGTATACAGCCGTTGCCGG
CGACACGCCTCGTGTCGTCGTACCGGACCATGGTGACCTGCGTCTGCACATCATGTATGTCGAGAGAAGACATATCTCACAGTTAGTCGCGACTTTTACT
GGCTCCGCCAGCATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTAAAGTCAGGTACTTCACTTCGTGCGCCGTTGCAACCCTT
GCCTATTCCGGCAGAATACTGGGAATCAGTCTCAATGGACTTTGTCTTTGGATTCTTCGCAGACCCACACAAGAATACAGGTATTCTTGTGTTCGTTGAT
AGATTCAGTAAAATGGTCCACCTGGTCGCTGTACCTGAATCTATCAATGCATCGGCATGTGCTCGTGTTTTTATCGACACGATCTTTCGTCTTCATGGGT
GCCTCGTGAACTCGTCTCTGATCGAGACCCACGGTTCACTGCGGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACCTCT
GACCACCCTGAAACAGATGGTCAGACAGAACGTGCGAACCGCGTTCTTGAGGAAATCCCATCAATAACTCGGTGCATGCATCGACGATGCATACACCGTT
CTTCGTGAATGGCTTGTGTCACCCACGCCTACCAACCTTCTTAGAGTGTAACTCTAGTTTGAGGGGGAGAAGGAATCATTCGAGCGAACGCCAACTCGGC
TCTCACTCATTACGTACTGACCACGAGGTTACTACGTATGACGCCGATGTCGATCACATCGACTTGGTGAAGGAGAGGAAAGTAAGAGCGAGGATGCTCT
TACTTCCCAGGCCACAGATCTTGCCAAAGTGCGCTCCAAGAGCACTACAGCCAAAGACAGAGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACGGTT
GTCTGTTTCGTGCAAGATTCCATTGCAGAAGCAGTGGACCGACAAAAGAAAAACGCAGACAAGAATGGAAGGGCAAATGTTCTTTTATTCAACGAAGGTG
ACCTAGTCCTACTATCTACGGTAAACTTACCTTGACACATAGTGGCTAACGTGGGTAGTAACAAGTTACTACCCAATTTCATCGGTCCATTTCGTGTGCT
GCGCCGCATAGGCAACGCTTACACGATTGAACTGCCACGTAAGATGCGCACGCATTCTACGTTCTACGTCGGTCGCCTTAGACCTTATCACCAGTACGGG
ACTCCTTCCGGTGA