Description :
From Genome Similarity Track
Location :
contig_5:587016- 589531
Transcript NameFunction/comments
g1626.t1XP_009516669.1 hypothetical protein PHYSODRAFT_358674 [Phytophthora sojae

Sequence
2515 bases(100 bases per row)
AAGAACTTGTTTGCCTATTTACGGCGTCCTCCTCGTTCGAAAGCGTCGGCAGTGCCGTCCGTCACGATATTGAACCATGACGCGGGAGCCATGGATGCAG
CTGCGGAGGAGCGGGGCTCTTTTAAGAGGATGCCGGGAGGTGACCGGAGGCTGAGCATCGCCTCTGGTAGCTTTCCGATCCGAATGGGAAGCAAGGTGGA
GCTGCAAGGCTCAGGACGAGCTTTACAGGAACCACTACAGCAGCTGCAAGCAGAGCATCCACAACCTACACAACAGCAAGATGGAGATCCTCCTCTGATG
AACTCAAGTCTTTTGCCTGCTTCAAGATTTTCAACACCAGCTTGCCGGGGTTCGATGCTTGGTTCGCTGAAAGCGTATTACCGCAAACTGCGCACGTTCA
AGGGAACTATCCGCGCACTTATCAATCTTCGACGGACCCCACTATCATTGTCCAGTGCCGTTAAAGCTGCCTCATCCGTATCAAATGGTAGCGGGGACCT
GCGAAGGTCCGGTGACTACTTTCTGCTTGAATGGATCTGTGAGGTACTCATGCTACCGTGTTCGTGCAATAGAAATAGTGCCGTACTAGAAGTTCCGCGA
ATATCCGCAGCTGGTGCTTCCACTGTCCAGAGTCAGGTGCAAAAGCTCGTAGCTGAAGGGTAGGCCTACTTTGCCGTGCGCTGGAGACTGTGGCCGCTAA
ACATATTTTTTGCTCCGGACAGGCATGTTGTCGCCGAGGTTGATCGGACATCAGGCATGGAGGTCACCTATCGCCAACAAGGCAACCTGGATCATTATAC
CGAGGTACGTCCAAACTAGAAACCCGGTTTTCAATCGCATGCCTCAAGTCATTGTGCGCAGGACAACCTGGCAAAACGCGTAAGCCTACAGCAGGATCCT
CACATGATTGCACTAACTCAACGCCTTTGGAATTGCGCGCTGCGGAATGGAGACAAAAAGCTGAAGTATGGCGACTACGAAACTTACATGCTGTGTCTGC
ACCGCTTGATCCTGCCCGAATTTGACATTGCCGCTTCCAAAGAGTTGATCGCGGACGACTGGAAGCGAGACAGCGGGGAGCAGGACTACTTGGACTACGC
TTTTTTTCACTTGTCGATGTTCGAGTTGGTTGGTACGTATGTTGAATATTGTTACTCAACTCGAAATCTTTCGCTGGGAATGTTTAACTGACGGTAATAC
ATGCGTTCCCAAGATTTGTGGACTGACACTGTCGATCCCGAAGATGTACGTTGCTGTTGCTGTGCATAACCAATATTGGATGGATTAATCACTCTCGCTT
GATGTGGGTTGGTAGTACATCTCGCTGCTTTATTGCATTACCCATTGCCTGACATACCTTCTCAACGAGCATCACATGCTAAAATCTCTTATAGGTCTCG
GCAAGAGTTTGTAGCGTGAAGTTGTGGTTCGCTTTGCTCATCGCTGGTGTGATATTATTGCATGTAGATGTTTCCAACGTTGACATTCTGAAAGAGTCTA
AGGGGGTGACACTAGAAATCATCAAGGAGGACTTGCAGCGAGAGTTAAATGGTGAATCGTTCGCATATTTTCGGGACCAGGTCAGGCTCGTTACGAAGCA
AACCAAGCTGCGGAGCGAGAAGTCACTGGAACTAGTAGACCACGCCGAGTATCGCAAAGCCAGCAAGGCAACAGATCGCGGTCGCGAGACCGTAAGCGGT
CAACGTCAAGAAGCGGTGAAAAAGATAACTTTCCCGGAGGTACCACTACGGGTGCGTAAATTCCGTTTGCTGCTCTGCACGGCGAGGTCGTCTCGCCATT
CAGTATGATTCTTACGGGTAGATGTATTCGCTAGATCTGAATTCGCAGCACCGTCGAAGTCGATCTGGTAGTAGTGATTTTGGCCAAGATCCCACAAAGC
GCAAGTTCTCCGTTCAAGCCAGTGCTAACTCTCTTTATCTCACAGCTAATGCATCTGGTAAGACGTTTCTCATTCTTAGTGACTAGGAAATAGCCACCAG
CAAGTGCTGTTTGACTAACCGAATTCGTGTTTTGATACTTTGTGTAGGATTCGGCAGCATCAACGGTGGAGCTCCACCCTTGACAACTCAGACCCAGAAC
TACCCTGCTGACGCGATTCCAGTGTCCCCGAGGCGGGAAGTTGCGCTTCAGCGAGCAACTTCGCCAAACGTGTTCGCTCGCGGTGGCGGTGTAATCCTGA
ACATTGGTACGATGGATGGCATGGTAATTTCGATGTCAACCGCGGACGGCAAGTCTTCCGCTGCAGTATCAACAACAGGCAACGCAGCTTTTCCTCGGCG
AAGGTCCAGAAGCGCTTCGAACTCGAGCCAACAACGACGTGATCAGGCCATGCAAACGGCCGGTAAAATGGACATCACCCGTGAAGCAGGGCTGCAGGTG
AACCATATTGAAGCCACAAAGTCGGTACTTCGGACAGGCTCTCAAGACCCCAACGCCGCGGGCTACATATTACTTCCGAGTGCATCGTCTGGAAAATCGC
GAGAGCCCTTCACGG