Description :
From Genome Similarity Track
Location :
Scaffold_1485:5870- 8053
Transcript NameFunction/comments
Phyta_totarag13100hypothetical protein
Phyta_totarag13101hypothetical protein

Sequence
2183 bases(100 bases per row)
GCCTGCACGAGGCTATGCGGCTGCCGCGGCGCCAGCGCCTCTGCGTTCACCAGGGACGGGTCCCGATACGGCGTGAGCAAGCCCACGTAAAACACTGGAT
GTGTacgcatcttcttcggaaGGTTGAGCGTATATGCTAGgcccttcttggccacgacctTAAACGGTCCGACGGAGCGCGggcgcagcttcgtcttaAA
GACCGCAGAAACCGCATGTGTAGGTAGGTTTTTAGCATTCAATAAAACCAGGTCCCCGACCTTGAAGCTTTCCACATTGCCTCTCCTTTCGCATTTGCTT
GTTCCTTTTGAACATCTTGGCTTTCAGCCATTGCGTCACGGACATGTCGAAGAACATTGAGACGCGTTGACAAGAAGTCATTAACCTGCTTACACACAGC
AGAAGGGCTGACATCAGCTACCCAGTCGGCATCTCCTCCCCCaccaagcccaaggccaCTGCGTGACGATGTGAGCGGAGCATGAGGGTGGGTCAAGCCG
TTGACATAGAACGGGGTGAAGGCTGTCGAGGGATGCACCGCAATATTCAATGCAAACTCCACGAGGGGAGCATGGTGCTCCAACGCTTTGGCGTTTCAGC
GCACACGCTGCGGAGGACGTCCTCCACAACGCGATTAACGCGCTCAGTCTGACCGTCGGTCTGCGGATGATCCGCCGTGGACATGTCCAAGCGAGTGCCT
AGCACCACGAAGACGGACTTCCAGAACTTTCCCGTAAAACGGGGGTCTCGGTCCGAGACGGACATTTCGGGGAGGCCATGTTGTCGAAAGGCACGGTCGA
GAAACAGCGTAGCTGTAGCCTCTCCGTCCACGGAGTCCGGCACAGCCGCCAAGTGAGCCATCTTGCTCAGCCGGTCGACAAAGACCACAATGCGCGTGTT
GCCCGCCGACTCCTTCGTCAGGCCAAACACAAAGTCCATGCTCATGGAACTGGCAAGCTCACCAAAGGCGCGGCCGAATGTGGCGAGGGCTTCACCGTTG
GCACGTCTCACACGTGCGCTAGTATGTGCTGGGCCATTTGTACAGCTTCGGCCACCAGTACATCGCGCTGACAGCGCTGTACGTCTTTTCACGGCCCAGA
TGGCCACCAAGTAGGGTATTATGGGCCTTATATATAATGCGATACTTCAAGTCCTCGTCATGATGGACTACCACGCGAGGCGTGTCAGCCGACCCTGTGC
TGTAGTACAGCAGGCCACCATCGAGGATATATCGATGTAGCCTCGCGCGAGAACGCGCcgacatcttcgtgtccGAATCGAGGAATTCCTTGCTCCCAAG
AGCACGTAGTAGGGCTACACAAGAGTCGTCGCGTGCGTAAGCTGCACAAATAATGTCTGCCACAGACGTCACTGTCGTGACAAGAGCAAGCTCATAATCC
GGTCTGCGTGACAACGCGTCGGCCAGAACATTCTGTTTGCCTGGCTTATACTTCACCTCGAAGTTATACTCCGCAATGAAGGAGAGCCATCGGGCCATTC
TCTGAGAGACGTGAGGCGACTGGGTCGCAGTGCGTAATGACGCATGGTCCGTGTAAACCACGAAAGGCTTGGAGCCGAACAGGTGGACCCTGAACTTGAC
GAAAGCGTACTTGATGGCAAGTAGCTCTTTGTCGTGAACTGGGTAGTTCTTCTCAGCAACCTTGAGCTGCCGAAACTCAAACGCGATCACGCGTTCGCGC
CCTTCAGCGTCCGCTTGAAGCAAAGCGCATCTGATAGCGAAGTCGGAAGCGTCACACACGACGCTGAACGGATAGTCCGGGTCCGGGAGCGCCAGGATCG
GCGCCTGAAGGAGGATTTCCTTAAGGCTCCATGTTACCCGGTGTTCCAACACCACTCAGCATCCTTCTTAAGGAGATTCGACAATGGCCTTGCCAACTCA
GAATAATTCTCGCTGTACTTGTGCAAGTAATTGGCGAGGCCAAACCACCTGCGTAAGTCCTTTTGGTTCTTTGGAATCGGTCAGTCTACAATGGCTTTAA
CCTTGGCGGGATCCGCTCGAAGGCCTCACTTCCCAATGAAGCACCCGAGGAACGGAATTTCTTCCGCGCCGAGGACGCATTTGTCAGCGTTGGTATACAA
CTTGCTGGTGCGCATGCactcgagcactgctcgtAGATGGTCGACGTGGTTCTCCACATCTGACTTCCCGCGCTCCGCACGAC