Description :
From Genome Similarity Track
Location :
Scaffold_94:58687- 62036
Transcript NameFunction/comments
Hyaar_Emoy2809088hypothetical protein
Hyaar_Emoy2809089hypothetical protein

Sequence
3349 bases(100 bases per row)
TGCTCCGCACTTCAGACGAGAGCAACAGCGGCAGTCGTATGGCGTCAATGGTGGTTTGCACTGTTTGCGCCATGTCGGTCGGGTATTCGGCGGCGGACGT
GGTAGGGTGCGTGCTGCTTCGGACACAGCCGGGTCGGTGTGGAAGTGGACTGATTTGAAAAAAGTTTAAATACAAGTGGGCAACGACTTGGGCGCACAGT
CTTTCTTCTTTTTTAAGTTTGAGCGGGGAGAGCAGCCGTGACGGGGTGGCACGTCGGTTGACAGAAACCGAGTTTTGATGTGGTCAACGAGGCTACCGTT
CGATCGTACAGTATCGTACCGGTCCAACGGTAATGGTCGTAAGAAGTACGTCAATCAGGAGGCTGGTGTTTGTTAAATGGACACGTACATATATTGGAGC
TACTACAATAGAAGGGAGTGTCACGGCACCCCACATTTGGTAAACGGACCCTATTCAAGTCCAGTTTGGTTCACGGCACCGCACCAAGAAATCATCAGCT
TGATTCCATTTGCCACCCCACAACTAGTTACGGCAATGCGTCAAAATCGTTTGTGGGGTGGCAAATAGAACTTAGCTGGAGAATTGATCAACTTATCACA
CCTTTGGCACTACATCCATCACATTCTGGCACGCCAGACCATATTGACGGTCCTTATTGTTCAAGCTTTCAAACGCAACAAGAGGTTGATTGCCCATACA
CACTGAATGAAGACTTTGGAATATAAAACGGCTTCTATCGCGCAATGCGACTCTGAACCTGTGGCACCTACTATGTGCGTTGTTTAGGACTAGCCTGGTA
TTGCCAGAATCCACGATAAGGGTGAGCTCTGCCGTGCTTTAGCGATTTTGTTCACATGCAGAAACGACATTCCTGCACCGTTTGCCGCCATGAAGTACGG
AAAATACGTGGCCCTCGTCGACCATTTACTACCCCAAAAGATCGCCCGTATGAGTAGCCGCCAAGATTGCGCAACCTGGAGTGGTCAGCCGGTTGGCTTG
CGGCGCACATCTACCATTTTTCTATGCCACTCACGTCACCCCTCAAGTGTAGCCATATCGCTACAAAGAATATTTTGCCAAAACAAGCCTTGGTCGCGGC
AAAATAAATCACGATCTGGCGCCGACCATCCGCAGTGTCACGGTTGCGCAAATGGCATGAGATTGCATGGAAGACGCCGTGCTAATCCGTTATATATATT
CCAAAGCCTTAAATTCACACCTGTGGCGTTTAAAAGCTTTAGCAATTAAACTATTCAATGTGGTGTGGCGTGCCAGAATGTGATGGATGCAGTAAAAAGG
TATGGTGGTGGATACATATATTCCTTTAGTTACGGGAATTGATAGAAAAACCAGAACAGGAGGACTTCTAGGCCACGGGAAATGGTATTAGGTGGGACGA
TCATTCAAGTGGCTACAATGAGTTGTCAGGGTTTTAATGCTGATTGTTAGAGTATTGCTGTTAATACTGTAGATTCGCTCCTGCATCGACTGACGGGGCG
CTAAGACGCCAATGGGCGTCCTCCACCCACCACTGTCGCACGTGCAATTGCAATGATGTGTCATAATTTGAGCTAATTGGACGTACCATGACTGTATGTT
GCAACAAAATTGCAGGGTTTATGTCCGATACCGCAACTTGTAGAGCAAGTGCCGTTGGCATCGCATTACTTCACGGTCGATCTTGTTGTCATACCTGAGG
AGGTCATCCGCGTCAGTGCCAATTGCCGATCGATGGTACATTCTAGCTTTGGCTGAGAACGACTTGTGGCTTATCCAACTATAGAAAAATCTGCACTTTG
CCTCGCATCGTGCAATCGGAAAAAAATGGCTCCAAAAGTTAGACCGATACACCATTGGCGGATGGCCTCGAACACAGTCAACAACGTATAGCTGCGAATA
AACGCTGACACAGTGATTTATCATCGGTCTTGCAGTGCTTCAAGCGTAGATGTTAAATCGGACGAGCAACGCAGATAGCTTAATCAAGGAACCATGAAGT
GCAAGTCACTCAGAAAATAAAATAATGTGTAACTTGTTGGAAAGTCTTTTTAATCCGCACTTCGCAAGACGGTATGCATACCAACACGCGTCTTATCTTT
TGGCTTGGTACAGTGTTTCGTAAAAGATCCCTGCGAACGTTGGTACTACACGTCATATTGTCATTCGTAGTTATTATAGCGTTGATTGTTGTGCACACTT
TGTCACAACCTCCTCATTAATAAGCTCTGACCAAGTAGAAGTTGCGCTTTTATCGTCACCCTTCAATTACTATTTCCTTTTCTTGCAACCCCACTGTCGC
GACGTCATAAAAGTGCAAATCCTAATTGTCGACATTCCCCAGTCGTGTCACCTGCATAAACCTAGAAATCATGTCGGACCCGCCTTGTCAAAACCATGAG
GGCGACCTCGTCAAGGACTCAGCACGGAAAATGAATACGTCAACAGCTAGCACCGTTGACGATGTCCCACCGGCTCGCAACGATGGCAATAATAAAGATA
TTGGCGAGTTGCGACGACAAGTGGGCCGTTTCGTGGTACACACCCAGTAGACAATCGATTCGCACTTAATGCTGTCCGCATGGGTCTCCCGGTCACGGTC
ACCACGTCAATCGTGGCCTCACTCAACCTTAGCGGGCTGTAAAACAGGTTTAACCGTGTCGATGATATTCCATTGTGGCAATTTGCACGGCGAAAGAAGC
TGCGTGTCCGGATGATTCGCCAGTCACGTCAGGACCCCAGTGTCATGTACGTGTACCACACACCATACCTACAACGCACTGTACTACGGGACGTGCTACC
ATCAACTTTACATACTGAAGTCAATGGGAGAAAGAAAAGGAAGAATCGCCCACTATCCGGCCATTCGGCGTCCGTGTGGACGAGGGCTCAAACGAGTGGA
TTTATTCGAACTTCGTGTCATCGCATCGGTGCATGACGATTCAATTGTTACAACGGTGAAGTTCTGTGTGATAAATTATGGTATTGTTGTACTTACGTTG
TTTTTTACGGATACTGACTGGATCATGTTTTGAAGGCATGTGGAAAGCAGCGGGAGCGTAGCGATCTGCAACATCACACCGCGAAGGGTTCGTTCCGATA
CTTGTGCTCTTGTTCATCTAACCTGGTTAGTGGATATCTCGATAATTTGCTTCTTGTATAAGTTTAGCCACTACGAAACGGAGACTTTGCTCGAGAGCTG
GTATCTTACGGTTACGCAGAGTGTATCCCGGAGGATCTATAGAATTACGACAACGGATCGTATGTGACGAACATTGTCTAGTATGACTTTTGTCAGCAAC
GGACTTTCCGTGCTTACGATTGTTTACATTTAGACACGGTTCACAGTTG