Description :
From Genome Similarity Track
Location :
Scaffold_785:5868- 6943
Transcript NameFunction/comments
Phymu_g11961hypothetical protein PHYSODRAFT_510403
Phymu_g11962ubiquitin-specific protease, putative

Sequence
1075 bases(100 bases per row)
cctgctgctcctcgtcagCAACGAattgctgctcgtcatcgtccatGGCCGAAACTTGAGTCAAAGCGCTATTAGATTCTGGAAGGCACCCCTTCAATAC
ACGCCCAGTCGTTTCGCCATTGGGATTTTTTGGTACGGATTTTGACGTTTTGTTTGAAATGTGCATCGCTTTGCTCTAGGAGATGCTATAACTGCCAGTT
CTAGGCCGTACGCTGACGCTTGGCATCCTTTTTCTTGCGCATCAGGGCCGTCTGGAAGGCATTCTTGCGGCCTTCGTTCGGAACGAACTCCTTGCGCTTT
TTCACCTTTTTCACCTTGCCCGTGTCAAGCGTCTCATCCCAGTAGTCCTGTCGGCGGGCATTGCGGTGTTTCCactcctcctgcttcaagGCGTTCAGTA
CACGGTCGTGTTTGGCCGCTAATGTActgtcgacagcttcatgtGACACTGCTTCACTGCTGGTCGTCTCGGAGGACTCCACATCCGTTTCACCGGCCCA
TTTCTCCACCTCCCGACCGAACAGCGCCGCGTTCCGCACGCCAACATTCTTAAGATGCCGCGGATCGAACGGAACTCGTGTGGTTCCTGTCGGCTttgct
ggagcaacagcgacagcaatAGGAGTCACAGCTGCTGCCTCCGCTACTGGCAATTCCGTCACAGTTCGGTTCATCACAAGACGCGGACAGGACTTCCAGT
GTGCCGGTCCAAACCTGTGCAACCGACCGACCCGACCTCCGAAACTAGGGGTCAGCAAGCGCTTGCGGGTGTTGACTGGCGTTTTGTTTGATTCAGAAGT
GGACGTGACCTTGAAcgtcaccaccgtcttgttcCGTTTGTTGGACTTGGCAGGAATCACAGCGAGAGCCTTGTCACCACTGGCATCTGATTGCGAGGTC
ACTGTCGTTTTCAAGCTCGCAAGGAACCCGTTCATGTCGAGCTCCTGGGTTCTTGCCAGTACCGTCTTCGGTGCTGCCTCCTTTTCCTTCTGCTTTGCCG
CCTCCACGACCTCTTTAGCCTTCGCTttcacctcctcctcttcttttGCTTTCGGCTTGGGACGTTCCGACGGAG