Description :
From Genome Similarity Track
Location :
Scaffold_539:5867- 11081
Sequence
5214 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCCACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCATGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCTGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGTATGGAGGGCGTGGCTTATCTTGCATCGCA
AGGTCTAGAGGCGCCCACCGCCAGGCTGGAGCCGCTCTCCCGCTACGAGAACGCGCTTTTGGAGCACGCCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCATGAAGAGTCTTTGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGCAAGATAGAGAAAATCTCCTTCTCTGGGCCC
GTGAGGTCGAGATGGTCATGGGATCGGCCCTGCTCCAGTCTCAGCATCGGCGCGTGGTGCTGGTTATCTCCAGGCTTGGCGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGCCTGTTGACGCTGCATTTCCCACTTGAGATCCGTTGAAGCAACAGCTTTCGCGTGTGTTCGCTCCGCCTAATCAGGCGTACCGT
ATCATGTCGAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTTTGTCCAAGTGTTGAGAGCTATTATCGCCGGAATGGCGGCGGACTCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTCACGGGGGACTTCGTGTGAGCACAGCTCGAACAGAAGTGTTCCGTGTACACCCTAACGCTTTCGAAGAGCCG
GTGGGTGTGGCATTGAATGCCGAGCACAGCTTCAGGGCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGATCCAGAGCCGATGGACC
TCAGCTATGCTAAAGATGCAGAAGCGGGGCTTCTTGCTGTGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCGATAGGATTAAGCACTTGAGGGC
CTATTGCCCTCTTCGCAAGAAACGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAGCTCCCAGTAGGCGCGGTGCGACCTACTG
GGAAAGAGCTAAATTATGTTGTGCCTCGAAGAGGTAGAGGGCAACAGGCTCAACTCCGAAGAGAGTTGAGCTCTTACAAGAAGAGTGTGTGCAAGCCGGG
CTTGCTGGTCGCTCAAGCGAACATGAAAGGCTTTACAAAGCCATGGAGAGTCTTAATTGACTCGGGAGCCTCGAGCAACTACGCCCGTCGCTCCACCCTG
GAAGGGAGTCAGCTGTATGCTGAGGCACGATCTCTGTCCGTCTCGCGACTTGGACACTTGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAGTGAAGTT
TGAGAATTTCGATAGCTTGGAACGCTGTTTGGACTTAGACCTGGATGCGAGGTATGACTCCATCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGTCGCATCATGCACCTAGTGGAGCTTTGG
TGGGTCATGCACCCACCTCTGCTAGGAAGCAGAAGCACTTTTGGCGCGAGCACGAGGCGAGGCGGCTGTAGTGCTGGACATTGGTATGCCCGGAATTGTT
ATCAACGAGGTTACAGTTTGTCCTGAGGGCGTAGGTGGTGCGGCATGTTATCCGCTGAGCGGTGCAGGTCAGGGCAATGACCAACTGCTGGGTCCTGGTG
AGGACGAACGCGGAGTAGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGCCCGAGGGTCGCGGTCGACTGCGAGTCGAGG
CATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGATCAAGGACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACA
CTGTATCCTCTTCGAGGAGTGATAGTTCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGACCGGGCTCGGTCGCGGAGGGA
GAGGAGAAGAAGACGCAGGGTGTCTGTGACGTCTTCGACGTCAGACGATGTGTCCAACGTGACGAGCGGTGAGGCTCCACGTGATTGCTGTGAACAGCTG
TACACACTCGTGAACGGAGTGACTGGGGGTGTAGAAGGCGACATCAGCCTTGACACTCTGCCCGCCGCAGAAGCTCCGCTAGAGATTGACGAGATGGCCA
TTGCCAAGTTTGGCGAAGCCTTAAAGACAGGCGAGCTAGCCGAGGTGGATCTGATGAGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGC
GGCCCTAGAGGACACCAAGAGAGCGCTGAGTGCAAGATGTGTTTTGGCGATCCTCAAAGATCCTTCGGATCCTTTCTACCCGGCGGTGAAGAAGTATGGA
GACGTTGTCTCGAAAGACCCTCCGACGGGCCTGCCTCCGGATCGAGGTGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGC
AATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTATTCCGCGCATTGCACAAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTTGAT
ACCCATGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATCGTTCATGCTTTTAACAAGTTAAATGCGGCCACTATCCCGGCGTAAACGCCGATTCCT
CGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGTGCCCTCGACTTGGTCTATGGTTACTACCAATTGCTCATGAGAGCGAGTGACG
CTCCGCTAATAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTCGTGCCCCAGGGGCTGTGGAGCGCACCAGCAACGTTCAATCGTCTTGT
GACGCAGTTGTTTAGGCTCCACCTGGCGTACGCTAAAACGTATGTTGACCATATATTTGTCCATAGTCGTGCCGAGCACGGAACGTTAGACGTGGAAAAT
CACATTGACCACTTGCGAGCAGTGCTCGAGTGCAAGCGCACTAAAGGTTGTATTCCAACTTGGACAAGTGCGTCTTTGGTGCGGGGGAGATACCATTCCT
CGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAG
TGGCTAGGCTTAGCCAATTACTAGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATTAGATCTCCTTAAGAAGGACGCACCATGGTGCT
GGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATACTTGCGCTACCGGACCCGGATAGTCCGCTTAGCGTCGT
CTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATTGCGTTTGAGTCTCGCCAGCTCAAAGCT
GCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCGCTAGTCAAATTCAGGGTACATCTAAGCCTTTTGTGATCTTTACTGA
TCATGCGTCGTTACAAACTACGCCACAGTCGCCTTATCTCTCTCAGAGAATGGCAAGATGGCTTTTCTTCTTTGCCGAGTATAACTTCGAGGTGAGATAC
AAACCGGGGCGGCTTAGTGTAGTGGCCGATGCGCTCTCGCGCAAGCCGGACTACGAGTTAGCTCATGTCACGATGGTGACGGCGTCAGTGCCTGACTTGA
TACGCGGAGCGTATGCATAAGATGGCACGTGCGTAGCGATGCTACGGGCTCTTGGGAGCGACGAGTATAATGACTCTGACAAGGAATTGTCTGGGCGCTT
ACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGTCTTCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGAAGGCGTTCCTCATGATGTAGAT
CTCAAGTATCGAATCCTCTATGAGGTCCATGATACGCCCGTGGGCGGGCACTTAGGTCGGAAGAAGACCCATGACTCGGTGGGCTCGATGTACTGGTGGC
CCAAGATGGATCAGTGGGTCGGCACCTATGTATGCACGTGTGAGACGTGTCAACGGACAAAGCCCGCGCCGAGCACGGCAGCGCAATTCGCGAGTTTGCC
TGTCCCCAAGGGATATTGGCAGTCCATGAGTATAAAGTTTGGGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCAA
TTGAGCAAGATGAATCATTTAGCGGTGGTGCCGGACACCATGGATGGTGAATGTACAGCTTTGCCGTTTTAGCCTGAGGCTTTCGCCAACATGGCTTGCC
AGAGGCATTTGGCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTATTCAGAGTGCTTGGCACTCTTTTGGACATGTCCACAGCGGCC
CATCCGCAGACCGACGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGTGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATAC
TCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTAAACGGCTTGGTTAACCCTCGCGTCCCACTGAC
GCCGCCACGCAGTGTCTCAGAGCTTGATGGGAGAGGGACAGCCGGGCGGCTAGCTGATGTCAACCCTGTTGCGTTTCGCAAGCAAGTCGATGACTTTGTC
TCTTTGAAACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAACGAACATGCAGATGCCAAGGGCAGAAGCAATGTTG
AGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAAAACCTACCTACTGATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGACCTCGGTTCATA
GGACCGTTCAAGGTCGTGGCCAGGTAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCAATGTTGGCTTGCTTAAGC
CATATCAAGACACT