Description :
From Genome Similarity Track
Location :
Scaffold_439:5867- 7831
Transcript NameFunction/comments
Phymu_g9920myotubularin-like protein
Phymu_g9921hypothetical protein PHYSODRAFT_535974

Sequence
1964 bases(100 bases per row)
GGGGGACGCATACTTCACGCACTAAAAAAATGAATGAAAGCGTTAGATACATTTTTGTGCGAACCATCAATTGATAAAAAAAGTTCAGCACCAGAATGGC
AAATTCGCACTTAGTACGATTGACCTTATCAGAAAAATCAACCAACCCAAGCAGCCACTACTGAGGAAAAGGAAACCGCTGCACGTTGGGAAAAGAAGTG
CCTAAAGCGAAAGGGTCGCCACTCATTGCCACTGCCAGCTTTGCCAACAGGATGGATCGGATGTCTAGTGGCTCCGTGCGTACGGACTTGATGCGGCGCG
ACGGCGCTCTGCCCTTCAGTAGTCGCCGCAGTGTCGAAGAAGATTCGTGGACAGAAGTGGAGCGACAGGAGCTTGACCACGCCGTAAGTTGGGAAGACGG
TGGCAATAACTTCTGTGTGTGTGCTAAGCTTTTCTTTCCATTTATGCCACTTTTGTAGACGTCGTTCGTATCGGACAGTATGTATTTGGTGATGGAAAAC
CCGGCGGGGGATCTCTACATGGGCGAGACGGTGTATTTCAAAGTGCACGCACAGTGTGACCAATCAACACTAGGGGGAGTGGCGGGAGTAACTGGCACGA
AGAAAACGGCAaaagacgatgacgatgtgATGCACGGAACTTTGTTCCTCACCAACTATCGACTACTCTTTCGCTCTTTTCATGTGAGTATTTTcatttt
cactttttttttgcgGTGCTAAAACCgtttattattattttttttttatttacCGGTAATTTATTTTTCTGGTAATTTTCATTCCTAGCAGCATcacgaa
gaggagctggtcgaagtTCACTTAAACAATATTGCAGAGCTGGCGGAATTCCGCGTGAATGGCACATTGGGTCCCATGATCCAGTTAGAAGTTTCATGCA
AAAACTTCGAGATGGTCAAGTTCAACTTCCCTGGGGAGGCGGTCTCAGGGGATGCGTACGTGAAAATCAACCAGTTGCTCATGGATAAACTGCAGCCGGC
AGCTTATGCGTTCGCTCGCCAATTGGACACTCGTGGGTGGACAGCGTACGACCCGCAAACAGAATTCACTCGCCTCGGATTTAAAACGCCGAAATCTGGT
GCACAGATTGGAGGGTATCGCATCACGTACGTGAACAACAACTACAAGATGTCGCCGACCTATCCCGGCGCGTTCATTGTCCCAGCTTCAGTGTCTGATG
GCGAGCTACGGAAGATTAGTTTCTTCCGAGCCCGTGGACGTGTGCCGGCTGTGACTTACCGACACAAAAATGATGCAGTGGTGGCGAGGTGTGCGCAGCC
TCTTGTTGGGCTGCGAAGGAAACGGTGCACTTCTGATGAAGCCTACATGGTCGCTCTTCGACGAGAATGCAAAGGGAAGCTTCTTTTCATCGACTGCCGA
AGCCAAACTAGCGCCTATGGCAACGTTGCACTCGGTGGAGGCTTTGAAGTGTACGTTTCGTGATGCAATGACTAACTACTATGTAGTATTCGGTATGTTA
ATTAActcttctttttttttgtcaTTTTTGTCTGCTGCCAGGCTCGATTACTACAAGGACACGAACATTATGTTTATGGGAATTGAGAATATCCATTCCA
TGCGAGATTCTATTCGCAAACTCTTCGACTTGATCAAGAATGAGGTTCGGGGCAACGAGCGACCTAATTGGCTGTCGTATCTAGAGGTATGTACTGCGCA
AGGCTTTTTTCTTGGATGTAATTGCTGGAGCTAACATGCCTACTGTTGTTTGCTTTGACTTAATTAAAGAGCACACGCTGGTTAGAACACGTGCGCTCGA
TTCTGGCGTCTTGTTCCGCCTGCCTAGCAAAGCTTATCGAAGGCACCAGTTTAATGATCCACTGCTCTGACGGATGGGATCGTACAGCCCAGATCACGGC
GTTGGTGAAGCTGTGCGCAGATCCGTTCTACCGCACCATGAAGGGGTTCCAGGTATATCGAGGC