Description :
From Genome Similarity Track
Location :
scaffold_155:58662- 62023
Transcript NameFunction/comments
g4743.t1hypothetical protein
g4744.t1 reverse transcriptase

Sequence
3361 bases(100 bases per row)
ACTTGACGTGTAACCCCGTTACACTATCCCCCCGTTAAGATTCGACGTATCGGTCCCGATTCGTCAATCGACAGAACTTGACCAGACGGGCAAGTCCCAG
AGAGAACACCCGAGTTCATTCCAAGATGAGTTCGCCAACGTCCTCGTCCGCAGCCACGGACGCGCAAGCCTCTCCTGCCGCCTCTGCGGCAGGAACAACA
GCGGCAGTGCCTGCTAGCGCTGCTGCTTCCAGCCATACGAGAGAGGGTAACCTCTCTCTCGGTCAATACTATGCTCTTCAGAAAGAGAAGCATGCAGTGA
AACCTTGCTACGCTGTCGACCCCAAAGAGCTCTTTGGGGACGAGGAGAATCTTATCGATTACGAGGAAGATCCTGAAGAGGGCGAGCTTGAAGACAAAGC
TCCTGCCCCCGTGTCTTCTCCTGAAGACACGCATGACCCACCCTTGGGGTCTCGACGTCCCCGTGAAGAGGCTCCGGACGCTTCCAGTTCGAAGCGTCCG
CGTAGCGACGATGAAGCGTCCCCGATGTCGAGGGCGCTCACCTCTCCGCGCACTGATTCTCCGCCAGTGCACGCACCCTGGATGCCTTCCGAGGCTGAGA
TCCAGGAGCGGTTCGGTGCTAGTTGCCCACCGAACCCGATTCTGTTGTATCACGACAACAGGATCATTGACGACGAAGTCGCCAAGAACACGGTCTTTGA
GTCCCCGACTCAAAGACGCGACTATTACATCGGACTCTTCCATGAGCTCCGATACTTCAGCGCGAAGAAGACTTCGCGCAAGAGCAAAGTGCCAGAGTGG
CAGGCACTTTGTCAGTCGTGGAACGCCTTTGTTGATAACTTCAACAAGGCTGTGAAAGCCTATCGCGAGCGTGTTGATAATGCTCGCGAACGCCTCCATG
GCCTATGCATGGAACGGGAATTCCCTGCGCCGTGCCCTTTGGCACGAGCTGCCCGTGCTGCCTGCCGATGGCAGCACGCCTCTCTGAAAGTGATCTTACG
GGGTACACGTCGGTGCGTGTACTCGATCACATCAAGGAACTCCGTACTCGTATTGAGCCACGCGAAGCTCCGAGTGCTGTGGCTGACCGCAGCACTCCTC
GTGCAGGGCTTAACCCTGCAAGTTATGGCGGGATTCGTACGCCCTCACCATTTCCGGAACGTCCTCCATTAGGGCGTTCCGTAGTTCCCATGAATCTCGA
TGGGGAGGAAATCCTCTCCAACGAATTCGAAAACGACGACTTTGATGGGTAGTCGTCGTATGATCCACGATCCGCTCAACTATCCAGCGGATCGCTCCTC
TCGCGTCGCGCAACGGCGGCGGAGGGGGTGGGAACACTCCCTGCGTATGGTCGACGCTATGACCATCACGATCGTGCCCTGCACGATCGAGTCGCTGCTC
TCGAGCGATCCCAGAGCGCTGAGATAGCGTCTCTGCGTCAAGAGGTGAGGAACCTCCGTGCTGACGTCGCCGAGGCGGCTCAGACGGCCTCAAACCTCTC
GTCCAGCCTCGGGTCGAGGCTGAACTTGTATGTCGAGCGTCTCCGCGAGCTCGAGGAGGCCTTCCAGGCCTCCCAGGCGAGTTATCAATCCTAGATGACT
CGTGCTGCAGGTACGGCTTCAACCGCCCGACGTAGAACGTCGGATGGAGCCTCATGCTGGATGGTATGTCCAGCCGGTACGCGTTGCCGTGCCGTTCAAG
TACTGTGAACGGCCCAATGAATCTTGGAGCAAGCTTACTTGCTCCAAATTCAGACACTGCATGTTTAGGCAGGTTTTGAGTAGCTAACAAAACCAATGAA
CCCTTTTTGAATTCATTCATGTTGCCCCTGCCAACATTATCAGCGTTCAGCTTCTGTCGATCGACAGAAGCTGCGATAGCGTCTTGCACAAACCGTATCA
CGGCTTGTCTTCGCTGGACAAAGTCTAGCGCGTTCGAGCTGAATCCTTTCAGCTCGTCGTCTTCGTCCGCAGCAGGCCCTGCCTGCGCGCTATCACTCCC
TATGTCTGTGCCCGGCACAGACATCGCGCGTCCGTTCCTACTCGAACGAGACGCTGCACGCGTCACCGCAGCTGAAAGTGTGCTATCAGCCGTATTCTGC
GGTTGTTCAGACGCAACCATAGATCCCCCCCCCCCACTTAAGGAGGAAGCTACCCCGCCGAGCATGCTCGGCAAACGTGGATGCCTCATGGCGTTCACGT
AGAACGGTGTATGCCCAGTCGAGGCATGCACCGAGTTGTTGATGGCAAACTCTGCCATCGGCAAGCACTCGCTCCAATGCGGGAACGAGTGAGCGTAGCT
CTTCAGCGCGTCACCCAGTACACGGTTGACGCGTTCGGTCTATCAGTCCATCTGCGGATGATCCGCAGTCGACATTGACAACTGTGAACCTAGAAGTGTA
AACACTTCTTGCCAGAACCGCGCTGTGGAGCGTGGATCACGGTCCGACACAATGTCGAGCGTCATGCCATGGTGTTTGAACACCATGTCAACAAACAGTC
ACGCAGTCTGCGCGGCTGTAACAGTAGCCGGGACGGCAGCAAGATGGTCCATCTTGCTGAATCGGTCCACAAAGACAACGATGCCCGTCCTCCGCTTGCT
GTCAGGCGGAAGACCGAAGACAAAGTCCAAGGACATGGACTGCCAACACTCCGACGGAGTCGGAAGTGACTGAAGAGGAGCCTGCGAGAACGGCGCAGGC
TTCACGCGTTGACAAACCTCACAAGCACGGACGTACTTGCGCACCCACTTGTACTGGTGGTGCCGGTAGAAGTCACGCGTGAGAAGAGTGTATGTCTTCT
CACGACCCGGACGCCCTGCCGTAGGGGCATCGTGATACTCGAACATGATCCTCAATCGCAGATCATGATCATTCGGAACGACAATGCGGTCCGCATTGTC
GTCTACTGCACTGTATAGCAGTAGCCCTTCGTGTACACGATACCGACGTACACGAGACCGAAGAAAAGGGGTTAGCTTCCGACGCGCCACGTCGAAAGGT
GCTGCGAGGTACTCCAGCAGCCCCTTCGCGTCTGCATCTCTCGCATACGCGTCCTTCACGTCGTCAATCAACGTTGACGACGGCACACTTGTCCTCACGA
CGCCAACAGCGTTGACGTCGACCGTCTCCGCATAGTCAGGTCGACGCGATAACGCGTCGGTCACTACGTTGAGTCTTCCGGGTTTGTACTCGACCCGGAA
GTTGTACTCCGCGAAGAAGGACAACCATCTCGCCATACGTTGCGAGATGTGCGGCGACTTAATCGCCGTCCGCAGTTATGCGTGGTCTGTATAGACCACG
AACGGTCTACCCCCAAGTAGATACACTCGGAACTTTGCGAGTGCATACTTCATGGCAAGGA