Description :
From Genome Similarity Track
Location :
Scaffold_25:586591- 588723
Transcript NameFunction/comments
Aphas_H257_09769TonB receptor activity

Sequence
2132 bases(100 bases per row)
CGCATTCCTTCTTGGCGCCGTGTCGGCAACACAACTGTCTCGCGTACGCTTGATTGGTGCAGTTGTCGATGATGCACATGCCGCGATGGCGGTGGAGCTT
ACAACGCCACGAGTTGTGCAAAACCACGTCGTTGCATCCGCTGATGAGGCACGTCCGGTCGCTTGACATGGTGTCGGCCGAAGGTGAATTCACGTTTGAG
ATGACGCCGGAGTAGTCGTGGACGGCCATGCACTCACTCCTCACAGGCAAAAAATGAGTATTTATTTTCATGTCTCGCGCTCATGTCTCTTCACTCAATA
CTGTAATATACTCCGGAGTACTTGTATGGATTTCGGTTGGCAACTTTGGATTTCAGACAACTTCGATTTTTTTGATTGGCCACCTCGTTAGAGTTTAAAT
ACAATGAAAACCCCGTCCTCGATGTGGACCTTTTTTTCGTTGGTCTCGCGTTCCGACTCCATGCATTATATCCCTCACTCTGCAATCGAACATGCCCCCA
CCAAGGTGGTACTGGCGTCTTGGAGCTCTTGTCCGACATGGTAAACTGACCATTTCATCGGTCTCCCCACGCTTTTAACCATCACACGACAAATAAAAGT
AGAAGTCATCAGACTCCTGGTTATTAGAGCATCTCCACTCGTCAGACTTAAAGGTCTGATTTATACGGATAACCCTTAGATAGGACCAGATTTGGACTTA
TACTCCCACCCGTTGGTTTTATTGGGGTCTCAATAAGTCCAAACATAAGTTCAGCCCCGAAAATCCCTATCATAGGACTTTTTCGTCAAGTTTGATGTAA
ATATCACCCGCCTGACTTATTCTATCCGGAAGAGTAATATAATCAAAAATAATATACAAAAGTACTACTCAACATAGTCAAATACAATACAGCATGCAAC
CTTTATAAAAATTCCCATTTACACGCTGTCAATTCACACTGATGACCAACGAAGGCTGACGTTGCGATGGGCCGTGGAGGTGACCGGTCTGCAGGCGGAC
AGGGCGGTCGCGATGATGGAGGTCACGAAGGTGAGTATTGCCGACGTGGTGGTGGCTAGGGACATGAAACGGACCATCGTGGTTCGCTTTGCGGCAGCTC
GGGAGCTTCGGGTGGGAGTCCTGCAGGCAACGGCAACAGGCGCCGCCGACGATTGTTAGCTCGGGGGAAATGCGCGCCGGCCTTCATAACGTTGCCCGTG
AGCCCCGTCAACAACCTCGGGATGTCGGTCCGCTGGTTTCCGACGCGACCCCTCGTCTTGAGATCAAGTCGTCCTCCTCTTCCGTCCACGCCACTTTGTT
CATCAACAGGCTCAGGTGGTCGCCCACCTTTCGTGATACTGCTGGCGGACCAACCGGGTGGCAACAGCGCGATGGACGACCAGTCGCTCGCGCCAGACGA
CTGCACCGCGACCACCGTCGTCCAGCGCCTTCCACGCTCTGCTGCAGGTATATGCGCTGCTGCAGGTGTATGGCTTCTATGATGTGTGCGGCAATGATAG
GAATTGACGCATTTACAGGTACTTCCAACAAGATGCCACGGGCGACCTTGTTTTCTCTATGTTTGCCAGTGGCATCGCGACAATGCTCCAAGAAGCAGCA
TGTAATGCGAAAGCACGCGACTTTCTCGTCATCGAAGGCTCGTATTACTCCCTTGAGCTATACTTTCGACGTAAATGTTAACTATTCGGTCAATGATGGA
ATGCAACGGGTCGCGGTTGATGTAAATGCACTCATTATCACTGTCACAGCCCCTTGTCGTCCCGCGCATTTAAGTCTGACGGGTGGGGAAAATGAAACTT
ATCACTGGAATCAGCATAAGACTCTAATTTATCCGTACATTATCCGTATAAGGCCAGGTCATAAGTCCCAACCGGTGGAGATGCTCTTACTACATCATAC
GTCTGTTGATGTACACATTTCCCATACAATGGTGTAGCCACGAATACGCGCAATGACAATCTTTGTACTTCATTACGAACCCCTGGGAGTTGTCATGTCG
ACGTGGATGGACAAGCAGGGGGGCTACGGCGCGCAGCCTCTTCGGGGGTGCGAAGTGCATGCCCCCCAGAAGCAATTCCATTGTACTAGGCACAGTCCAT
GTGTAAGTTATTGCATGGCTAACGGTACGTAT