Description :
From Genome Similarity Track
Location :
Scaffold_573:5865- 7460
Transcript NameFunction/comments
Phyta_totarag9363conserved hypothetical protein
Phyta_totarag9364hypothetical protein PHYSODRAFT_377272

Sequence
1595 bases(100 bases per row)
AGCATTTCGTTGTGCTCCTTTGAGGGGTTTCGCTCCGACGAAGCGCCGCTCTGCACCATTACAAGACATACAGCTGCAGTCACATTGAAGCAGGCTCCAC
GAAACCATGCAGGAATCTCAGAatgcagaagctcaagctcagcagGCAGAAGCCCCTGTGTCCGCTAACGATGTGAACGTCACTGCTATCAAGCCGCACA
AGTCCGTGAACAAGAAGGATGAGTACCAGGTGCTCTGCTGCGGTAATTCGTGGCAGGATCTGCTCATCATCCCGCTGTCTCTGATCGGGGTGTACGTTCT
CCTCGGCGCACTCTTCGCACTCTGCACGCGCTCGGTGCTGCAGACCGATGACACCAATACGGCACTCTGGACGTTTTTCGTCTTCTACGCGTTCTTCGTT
TTCATGCTGGGACTTGTGCTCGGGACGGTAGCGTACAACCGCAAGATGCTCAAGGCtcacgaagacgatgacCATGAAGACCTGTAAGAGCGAGGAACAG
ACAGCCCTGGCTGTAGTACGTCGTTAGCTGGATGGCATCGCGATGGCTTGGGCTTGTTGGTAGGACATTGGAACTAAATAATACTACGCATTCATCTCAG
AAATCTCAAATACCTCTTTCATTACCTTGGACTCTGTGCTAGGAACTCGAAGGCCGTTGCTTGTTGAGTCTAGTAGTATTCCGTGGCTGATTGTCGGCTG
TATTGGCAGGGCCAACACTGACAGATACGACGTTGTCGCCTCGAATGAAAAGCTGCTTAACGTACTCGCTTTGCGTGCCGCCTGCACTGGCAAGTACGCG
TCGGTTGTGGCGTCTATCTGCTGCCGAGAATACAACATCACTAACAATGCGGCTACCCTCACGCATCTCTCGCAGCAGCCTTTCATGAGTGGTATGAGGG
ATAAATTCTTGCGTGACGTCCAGCAAGACCAGATTCATGTGCTTATCAAACGCCTTCAGAAACCCCGAACACGTGCCACGCACGCTATTGACACGGCGAA
CAACGACCAACACCCTCATCCGCTCAAGGAAGCACCGACGAAGTACTCGAAAGGGTCCGTCCAAGTAAGTATCTGTCCCACAACATCAAGTAAGCAAAAA
CCTCTCTTAATGAAACAGCAAAAGAAAGCACAGCAAGCCCCAGTACAGTACCTGCGAGTTGTTCAAACAGCGACGGCGTAGCAGCCTCCGCCACCTTTTT
TACAACAGCCGCCGCCTTAGCTTCAACTGCAGATGGACTTATCTTCTTGGGTCTAACAACGAGCGACTGGCGGTTTGCATCTGACCCTGGCAGCTACACA
ACAGTTCAACTGTTAACTTAGGTACTCAGCAATACTAACATTTCATGAATTGTTGCATCTCAGCCACAGCCCGACGTACCAAATGACGACACTTTTGGAT
ATTATCCAGTGGATACGCCATCGTCACgggcagcttcagctgcttttTAGGAGCTTGAAGAGCTTTGAGAGCGTCGAATTGAGCTGAGTGAGAGTCCAAT
GGACTCTCGGTGGCTTTGGGCAGCGCGTACGGCTTGAAATCCCTCTGATACTTGACGTTGGCGAGcgttccagcgcctcctgcCTTGGCTCCGTC