Description :
From Genome Similarity Track
Location :
contig_17:586218- 587861
Transcript NameFunction/comments
g4109.t1hypothetical protein AM588_10009415

Sequence
1643 bases(100 bases per row)
CGTTCATGGAGAACATCCTGCGCCGCAAGCCGCTCAATGTCATCCACGCCGAGGAGTCGGCGGAGCAGCTACCTCGCCACTTGTCACTCTTCGACTTGCT
GTGCATAGGTATCGGAAGCACCGTGGGCAGCGGCATCTTCTCCACTGCGGGCGAGATCATCTCCAGCACGGCGGGTCCTGCGGCGTTCCTCAGCTGGATC
ATCGCCGGTGTCGTGTGTTGCCTCAACGCGCTCGCCTTCATGGAGCTGGTGACGCGTATCCCGTCCTCGGGCAGTACGTACGCCTACTCGTTCCATGCAC
TCGGCGAGCTGCCGGCCGTGGTGGCCGCGTGGCTGCTCACACTCGAGTACGGTATCTCTGGCTCCGGTGTGGCCCGTAGTTGGGCTACCAAGGTGCAGGA
GTGGCTCGTGGAGGAGCACCCGGAGCACACGTACCAGTGGCTGAATGAGGACTACACGAACCTGCTGGGAGCTGTGCTGATGGCGCTCTGTGTGGGGGTT
CTCCTGGTGGGGTTGCGCTTCGGCAAGTGGTTTGTCAACACCATCACCACCATCAAGGTGTTCATCGTGCTGTTCATCATCATTGTTGGCTTCTGCTTCA
CGGACTCGAGCAACCTCTCGCCCTTCGTCCCGCCTCGACAGGACGTGGACGGCACCATGGCCTTCGGCACCCAAGGAATCATCTCCGGCGCGTCGTCGGC
CTTCTTCGGATACGCCGGCTTTGACGAGGTGTGCTGTCTGGCTGCGGAGGCAAGGGACCCCAAGAGGATCATGCCGCTTGCTGTCATCGGCGTCGTGACT
GGCACCATGTTCCTCTCCGCCTTTGCATCGCTCGCGCTCTCGGGCATGATCCCGTATCTGGAGGCCCAAAGCTTCGGGTCTGGCTTTGACTACCAGGGCC
AGAACTGGGCGGCGCAGATCGTGCGCGCCGGTGAGACCTGCACGATGCCCGTGGTGGTTCTCGTGTGCTTCCTTGCCCAGCCGCGGCTGAACTACGCGCT
GTCGTGTGATGGTCTGATGCCGCGCATCTTCTCCAAGGTGGACAAGAACGGCAACTTGTTCGAGAACACGCTGATCTCCGGCGCTTTCTTCACGGTGGTG
GCCTTCGTGGTGCCGTTCGACACGCTCTGGGATATTGTGAGCTTCGGTATGCTGCTCTCCTTCAACATGTCAATGGCGTCGCTGCTGATGGTGCGGATGC
GCAAGGACTCGCCTAAACTGGCGCCCAGACTCGTTTGTACCATGGTTGCGTCGGCTTGTCTGGCGGCCTTCTTGTACCAGATCGGCTACTCCAACGAGGG
CCACGTTTGGTGTCTTGTGTTGAGCATTCTCTTCCTGGTGATCACCGTGGCCGTGTGCTTCGTGATGTACTTCAAGTGTCCGCAGGAGGCACAAAACGGC
GAGAACTTCGCGGCGCCGTTCGTGCCGTTCCTCCCCACCATCGCCGTGCTCGCCAACTTCTACCTGTCCGCTCAGCTGAGCTACACGGGTATCTACACAA
GCTTCGGGTGGATGGCTGCCAGTGTAATCTTCTACTTCGGCTACGGCTACAAGCACTCCGCTGGCAGGACCGGCTGGAGTGCACTGATGAGTCTGCCGCG
CGAGTCTTCGCTGCGCTCGCCCATGATTTCGGTCGACAAGAAG