Description :
From Genome Similarity Track
Location :
contig_5:586153- 588665
Transcript NameFunction/comments
g1403.t1TRNA pseudouridine(38-40) synthase

Sequence
2512 bases(100 bases per row)
GCTGCGGAGGAGCGGGGCTCTTTTAAGAGGATGCCGGGAGGTGACCGGAGGCTGAGCATCGCCTCTGGTAGCTTTCCGATCCGAATGGGAAGCAAGGTGG
AGCTGCAAGGCTCAGGACGAGCTTTACAGGAACCACTACAGCAGCTGCAAGCAGAGCATCCACAACCTACACAACAGCAAGATGGAGATCCTCCTCTGAT
GAACTCAAGTCTTTTGCCTGCTTCAAGATTTTCAACACCAGCTTGCCGGGGTTCGATGCTTGGTTCGCTGAAAGCGTATTACCGCAAACTGCGCACGTTC
AAGGGAACTATCCGCGCACTTATCAATCTTCGACGGACCCCACTATCATTGTCCAGTGCCGTTAAAGCTGCCTCATCCGTATCAAATGGTAGCGGGGACC
TGCGAAGGTCCGGTGACTACTTTCTGCTTGAATGGATCTGTGAGGTACTCATGCTACCGTGTTCGTGCAATAGAAATAGTGCCGTACTAGAAGTTCCGCG
AATATCCGCAGCTGGTGCTTCCACTGTCCAGAGTCAGGTGCAAAAGCTCGTAGCTGAAGGGTAGGCCTACTTTGCCGTGCGCTGGAGACTGTGGCCGCTA
AACATATTTTTTGCTCCGGACAGGCATGTTGTCGCCGAGGTTGATCGGACATCAGGCATGGAGGTCACCTATCGCCAACAAGGCAACCTGGATCATTATA
CCGAGGTACGTCCAAACTAGAAACCCGGTTTTCAATCGCATGCCTCAAGTCATTGTGCGCAGGACAACCTGGCAAAACGCGTAAGCCTACAGCAGGATCC
TCACATGATTGCACTAACTCAACGCCTTTGGAATTGCGCGCTGCGGAATGGAGACAAAAAGCTGAAGTATGGCGACTACGAAACTTACATGCTGTGTCTG
CACCGCTTGATCCTGCCCGAATTTGACATTGCCGCTTCCAAAGAGTTGATCGCGGACGACTGGAAGCGAGACAGCGGGGAGCAGGACTACTTGGACTACG
CTTTTTTTCACTTGTCGATGTTCGAGTTGGTTGGTACGTATGTTGAATATTGTTACTCAACTCGAAATCTTTCGCTGGGAATGTTTAACTGACGGTAATA
CATGCGTTCCCAAGATTTGTGGACTGACACTGTCGATCCCGAAGATGTACGTTGCTGTTGCTGTGCATAACCAATATTGGATGGATTAATCACTCTCGCT
TGATGTGGGTTGGTAGTACATCTCGCTGCTTTATTGCATTACCCATTGCCTGACATACCTTCTCAACGAGCATCACATGCTAAAATCTCTTATAGGTCTC
GGCAAGAGTTTGTAGCGTGAAGTTGTGGTTCGCTTTGCTCATCGCTGGTGTGATATTATTGCATGTAGATGTTTCCAACGTTGACATTCTGAAAGAGTCT
AAGGGGGTGACACTAGAAATCATCAAGGAGGACTTGCAGCGAGAGTTAAATGGTGAATCGTTCGCATATTTTCGGGACCAGGTCAGGCTCGTTACGAAGC
AAACCAAGCTGCGGAGCGAGAAGTCACTGGAACTAGTAGACCACGCCGAGTATCGCAAAGCCAGCAAGGCAACAGATCGCGGTCGCGAGACCGTAAGCGG
TCAACGTCAAGAAGCGGTGAAAAAGATAACTTTCCCGGAGGTACCACTACGGGTGCGTAAATTCCGTTTGCTGCTCTGCACGGCGAGGTCGTCTCGCCAT
TCAGTATGATTCTTACGGGTAGATGTATTCGCTAGATCTGAATTCGCAGCACCGTCGAAGTCGATCTGGTAGTAGTGATTTTGGCCAAGATCCCACAAAG
CGCAAGTTCTCCGTTCAAGCCAGTGCTAACTCTCTTTATCTCACAGCTAATGCATCTGGTAAGACGTTTCTCATTCTTAGTGACTAGGAAATAGCCACCA
GCAAGTGCTGTTTGACTAACCGAATTCGTGTTTTGATACTTTGTGTAGGATTCGGCAGCATCAACGGTGGAGCTCCACCCTTGACAACTCAGACCCAGAA
CTACCCTGCTGACGCGATTCCAGTGTCCCCGAGGCGGGAAGTTGCGCTCAGCGAGCAACTTCGCCAAACGTGTTCGCTCGCGGTGGCGGTGTAATCCTGA
ACATTGGTACGATGGATGGCATGGTAATTTCGATGTCAACCGCGGACGGCAAGTCTTCCGCTGCAGTATCAACAACAGGCAACGCAGCTTTTCCTCGGCG
AAGGTCCAGAAGCGCTTCGAACTCGAGCCAACAACGACGTGATCAGGCCATGCAAACGGCCGGTAAAATGGACATCACCCGTGAAGCAGGGCTGCAGGTG
AACCATATTGAAGCCACAAAGTCGGTACTTCGGACAGGCTCTCAAGACCCCAACGCCGCGGGCTACATATTACTTCCGAGTGCATCGTCTGGAAAATCGC
GAGAGCCCTTCACGGTCCGTGCGGCTGCTGTTGGTGGCAGCAGCCAGCATGGCTTCAGCCGCTGCGCCGGTGAAACCCCAGCAGGCACTGTCCATCCAGC
GCACACAGTTCC