Description :
From Genome Similarity Track
Location :
Scaffold_96:58615- 63897
Transcript NameFunction/comments
Hyaar_Emoy2809177succinate dehydrogenase flavoprotein subunit

Sequence
5282 bases(100 bases per row)
TACGCAACGCGATCGAGGTTGCATTTGGCACCAACCGTTTGAAATGGACATCCAAAAAAAGCATGGCAGCAATCCAAAAGCAGGGCAAGCGACCTTCTTT
TTTCCTGTTCGTGTCACCTATATATGTAGCGCAAATAACGATCGCCGGCACGTATTCGACCAAAACACGCTTCATTCTTCTTGTTTCAACACTTACGATG
CTGAGCTGACTTTCGTCTTCCCTATGAACGCTCCGTGGTATTACTCTACATGACTCTGAGATAGCTCACCTTCACTACAAAGCCAACAAAGGCTAATCGT
GATGGACACTGGTGTACTCGTGTAGTGTGTCACCAATACCATCTACATAACACGTCCGACGACTCATTCAGTGAGTCAAGCTCTGTCTCAGCCAACGACG
CATCGTCTGGTCGTATTGTCTCACCTTCACTCGCCACCTGCTCCTAGTGTAGTTACCTTTGGGATGCAGATATACATATCGTATCAGCAGGCGACTCTGA
GCTCGGAAAACGGGCGATGATTGTCTCGAATGATACGGGCTCGAAAAGCGCAGTTGATAAATATCTAAACTGTTGAGCTGATTGGAATCGTGGCCATATC
GTTTACGCACCGCGAAAGCAACTGCAAATAGCAATGTAGTGGCAGGATACACATGCTTGGTTGCTGGTGGTTGGTCACGTATAAACGCTTAACACGGTAT
TCTCAAGACCGTCCATCGGCACGCGTAGCGGCTCTGACGCCCACTGAATTGGCTTCGGATGGATCAGAACATAACGGTAGTGATGTGTTGCGCCTACGCG
TTATGCGTTTTCAAAACTGCAACTATTCTTGCGGTTCATGGGCCGATACAGACACGTCGTGTTGACTTGCTTCAAGCACGGCTTACTCACAGCTCTAGCC
GGGTTGATAAAGCACTAGAGAAACGCATGTGAACTCGAATAGTGACTGCCGCGTAACAAGACGCTGATGGAGCTTCTGATGGGTTTGTGTTCGATGGGTT
ACGAACAGCTACGCTTCTACTTACTATTCAGTGGGTGCCCTTCAGCACTTCGTTTACCGATACTTGCAGGAACCTCCTGTAAAAAAGCTCGGCTTGTGTT
GCGAGTCATTCGATCATTGCCCGACACCTGCACGGTTATCTGACTACGTTCGAATAAGGAATCTTTGCGAGGGAAGTTTACGTGTTTAGCCAGCAGTATG
ACGCCAAGCCCAAGGAGGCAACAACAAAGCTTGTCAGAGTTACTTCCAAAGAAACGAAAAGCTCTGTATCCCACTTAGTTTACCGTAGTTGTGAAGACCT
GAGCAGACTTCTGAATAGCTGCAGGGCTTGACGGCTGTGCAATCATCAGACACTTAACGATAATGTCGCAACATCGCTGCGACCTCACGGCATATCGAGG
TGCACCTGTGTACTCGTTGTAGTCGCTTTAAGCTCAAGACATGTTAACGGCCGTATCAAGGTCTCTTGGAGCTGAACTCGTTAGTCTGTACTTGTTGCAT
CAGCTTTATTTAATCGGGTTAAGCGGGTCACAAAAAACCTCTGTACGCGCTTTAGCAGCGTTCAAGGAATGTGTAAGGCTGTCAGATGCACGTGGTCTGC
TTGTGGAAGTCTCACTACATGACATCTTGCACCTGGAAGAGCGATATGCTAGTCGAGGCTGGCGCGTAAAAAGCTACGAGAGTGGAGGGGACGTCGTATC
CAGACGATGATGGCGCGACACGAGCTGTTCGCAAAACTGCATGCACCGTCAAAATAATCCTACACTCAGAAGCCGCGTGCGGGTAAGCAGATGACGCGAT
TAAGATACAGAACCTTGGTCCGAAGCTGGTAAATGCAGTCCAATACAAGCTGCGGAATGGCAGGGCCGCTTCACGCACAAATTTGAGAGACATACTTCAT
TGCGGATTGGGCGCAGAGATGCCAAGCTGAAAAATTGATACACTTAGCTTTCGTGTGCATCAAGAAGTGACAACCTAACAGCAACGAGAGCATCAAGCGC
ACGATACCCGACGAAATTATACTTAGCGTTGCTTTGTAACCATCATTAGTGTGACCAACGGGTGTAATGCACTCATCGCCAAATTCGATGCCCTGTACAA
CTGCTTCAAATATACATATGAGAGATGCAGGGTCTCACGAATTCGAGTGAATTCTTTACTGTTCTCCTGTCAACCAGCAGCTTCTTCGAGAGCTCTTATC
TTGCACGCACACAACTAGCTCTTCGAGTTGAGTGAGTTTATGCAACCTCCTACTTTCTAGTGATAGAGAGACTTTCCTACAAACTTCAATGCCACCAGCT
CAAACAGAGCCAACTGTCTGCATCCTCAGTCCCGTACCAAAGCAGAATCGACGCAGATGTCGAAGTCAAACTCGGTACACTAAAAAACATACATCCTCAT
GAACATTCACGTGGGCGACAAATGAATGTGTTGGTGAGGCACGTCGAAATTACAATACGACCATCCCCTTTGTCTCTTAACTACACGGGCAAAAAGCGCT
ATTGACAATGCAAGCGTCACCACAACATAGACTCGCAAGTTTGTTTAAAGCCGCCTACTCGTCGAAAACTCTAATCGTTGGTAACGGCTACGCTGTCGTT
CGAAATGGCTTTTCGTCGCAAAAAGCGGGCACGTTGTCAAATAAAACCTCGCACGAGGTTTATCCAGTCACTTGCGTTTCGTATGGTCCATACAAATCTC
ACGCTCTTCGTCTATCTGCGGCTAACATACGCCCTGATGTCTAGAACCCGCTCAGTTCCGCTTTTGCATCGATCCGTGATCGTGACCTCAACCCTCTCAA
AGATGATGCGCCCCTTCCAGGCCCAATCGCTGCGGCTGACCCGTCCAGCAGTCAATCGTCGTAGCTTTGCCGTCCAGAGCTCCAATGCGTCATTAAATGG
CGTGCACACGTCGGCGCTGACGTCCAAGTACACGGTTGTGGACCACGAGTACGACGCGGTGGTGGTAGGTGCCGGTGGCGCTGGGCTACGTGCTGCTATG
GGCTGTGCAGAGACAGGACTGAAGACTGCCTGTATCTCGAAGCTCTTTCCCACCCGGTCCCATACTGTCGCCGCCCAGGGCGGGATCAATGCCGCACTGG
GGAACATGTCGCCTGATGATTGGCGGTGGCATATGTACGATACGGTTAAGGGCAGTGATTGGCTGGGCGACCAGGACGCGATTCACTACATGTGCCGAGA
GGTGGGTTTACTATTTGGACTATTTTGTTGAATTTTATGTTGGTTTGTCAATACTTCGTGTGGGACACATACATTTATGGATTTGGTGTGGCATACATAA
TATGTGTGTGTTTTGTGGTGGGTGGATTGTAGGCGCCTGAAGCTGTGCGTGAGCTCGAGGACTTTGGGCTCCCGTTTTCCCGCACTGAAGAAGGCAAGAT
CTACCAGCGTCCGTTCGGAGGACAGAGTCTGGAGTTTGGCAAGGGCGGTCAAGCGCGTCGAACGGCGTGCGCTGCTGACCGCACGGGTCACGCCATGCTG
CACACACTGTACGGGCGCTCGCTGGCGTTTGACACGTCCTACTTTATCGAGTACTTTGCACTCGATTTGATCATGAATGACGCGAACGAGTGCGTGGGTG
TCATGGCGTTCAACATGGAAGACGGCACGTTCCACCGCTTCCATACGAACAACACGGTGCTGGCCACTGGTGGCTATGGACGTGCGTATTTCTCGTGCAC
GTCGGCGCACACGTGCACGGGAGACGGGACGGGTATGGCTCTCCGCGCTGGTATCCCGTTGCAGGATCCTGAGTTTGTGCAGTTCCACCCCACGGGCATT
TATGGTGCTGGATGTTTGATCACGGAGGGGTCCCGTGGTGAAGGAGGTGTCTTGCGGAACTCGGAAGGCGAGCGCTTTATGGAGCGTTACGCTCCAACAG
CCAAGGACTTGGCCTCGCGCGATGTAGTATCGCGTGCCATGACGATGGAGATCCGTGAGGGTCGCGGTGTGGGCAAGAATCAGGACCACATTTTTTTGCA
TCTGGACCATCTGCCGCCCGAGCTGCTGCATGAGCGTCTGCCGGGAATCTCGGAAACGGCTGCCATTTTCGCTGGCGTAGACGTGACGAAGGAGCCCATC
CCGGTGCTGCCTACGGTACACTACAACATGGGGGGTATTGCTACGAACTATCTGGGTGAAGTGGTCGTACCTGACGTTGTTGGCCTGCCGGAGCCTGGCA
AGTTGTATCCGGACAAGGTTGTGCCGGGGCTTTTTGCAGCGGGTGAGGCTGCGTGCGCATCGGTGCATGGCGCGAACCGCTTGGGTGCCAACTCTCTGCT
TGACCTAGTGGTGTTTGGCCGTGCGTGCGCTCAGCGCATTGCCGAGCTGACCAAGCCTGGTGAGAAGAAGCGCCCGATGCCCAAGGACGGTGGTCTGAAG
GCTATTGAGGACGTGGACCGATTGCGATACGCTGACGGTGGCATCCCCACGGCCGAGTTGCGTCTGGAAATGCAGAAGATGATGCAGGCGGATGCTGCTG
TGTACCGTACGCAGGAGTCGCTGGCGGCTGGCAAGGAAAAGATCGACGAAGTGGTGCCCAAGTTCGGCGACATCAAGGTGACCGACCGCTCGCTCATCTG
GAATACAGACCTGATGGAGACGCTGGAGTTGCGTAATCTGCTGGCATGTGCAGCGTGTACTATGCATGGCGCTGAAGCCCGTAAGGAGTCTCGTGGTGCC
CATGCTAGAGAGGACTTTACAGAGCGTGATGATGACAACTGGATGAAGCATACGATTGCTTACCATAACGAAGAGGGCAAGACGCACGTTGCTTACCGTG
CGGTGCAAGACCAGACGCTGGATGAGAACGAGTGCAAGCATGTCCCGCCTTTTGCGCGTGTTTACTAGCTTTGGTCAGTTCATGGTGTGTGCGATGGACC
GTACATTGATCACACTAATACGCGTGAGCTTGTCACGAACAAATACATAAGTTTTACACCAAACTCTGCACTACTGCTAAAATTTTGTGACAAATGAATA
CTCAGTGTCTGAATTCACTAGATACAAAACGTGTAATTTTTCGTTATTGGTGGACGGACGCCGTGAACAGCCGTCCTAAAATCGAGAATTTGCTCCTTTT
GTTGAAATATGAATAATGTGCAAAACGGTCTCTGGATGGATCAGCACTTTGTTTGAGCACATGGATCTATTTAACATCCTTTATGTCGAAAATCGTACCA
GCTACGCCTTACAACGAAGTTACCGGCCCCTGCTACTTCAACCGATCGAACTCCAGCCGGAGGCTTTTTATACCGTCAAGGT