Description :
From Genome Similarity Track
Location :
Scaffold_1311:586- 5185
Sequence
4599 bases(100 bases per row)
CCTCCCTACCCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAAACATAGAGCAATGCTCTACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATACACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGT
GATCTTCTCGACTTCTAGCTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCTGGTAGGCGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACC
GAAAGACGGGTTTGCGGCCGGTCCGGATATTCCTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACCAGCGATATTCGGTACCTGCCGTTTTCC
AGCTTCACCGCGTGTTCTCCTATCTTTTTCGCTCACCCGGAATTGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCCTTCACCCTATCTAAA
TAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGTCACCCCGGATCCTGTCTTGGTTGGTGTTCATCGCGAAGGGAAGTCGTTCTGCGTAC
TCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTCTGTACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGAT
ATGCCATGGTTGCTCGCTGTCTCTGCCCTAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAACCTGGCTCTCGGTCATGTCTAATCATCTCACT
AGCCCCAAGTCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAAAT
CCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATT
CCCAGGCGACTCCCCTTCGATCGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCACCGCCACACCGTTGCACGCTCTTAGATAGTCCCCTCCAG
TGGAAACATTCTCGGATCCGTTGGTAGGTCCGACCAATTCCCTGATGTCCACCTTCTAAACTAGCGTGGTAGTGATGTAGGACATCCTGTTGTAAGGTTT
CCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGAGGACAATAGAAGAGCAAGTCATTCAGATCCACTGCATAATCCGT
AGCGATCATACTGTAGGATTTGGAATCCTCCCGACTCAGGTCTCGTATATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGT
GCTTTGAGGATCGGCTCAATGCGGACTCCCTTCACAAATGTGTCCTCGAGGATCTGGGGGCTGGATCCAACCCTTCCTCTGGACCCAGTGACGGCCATCA
CCTGGACTGTCCTTTTCCCGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAATGAAACGAGATCCTGACGCTCGGCCTCTTTCTCCACTTCGACACC
ACATTGATCCCGTAAATCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAGCCACGCAGGTGG
ATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCA
GCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTTGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGC
CCGTACAACTTCCCATCCGGGTAGTCTCCACAGTATTGCACTGTACGTTCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGA
TCCTCATCTGCCTGTACCGTCGGGATTGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAG
GAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTATGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCC
CAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGA
TCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTTCGGCTGACGAAGGTGACTGGATGACAGA
TCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGG
CGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGCTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAG
ACTGGATCCTCTCGCCGTTGGCCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCT
CCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAAATCTACCTTTCTCAATTCATACAATACCGCGGCAAACAGGGC
TTAATCCTCGATGAACCGACTGTAGTAGTTTAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGG
TCCTTAGGATTCGCCTCCAATCCCTCCTTGGAATCTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAAAGAT
TCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCC
TAGCACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTGGGGTTCCGGTATT
CGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACG
GTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTCCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGA
TCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCTATGCACAGACGTATATCCACCCCGT
TCTTCTTGATGATGATTACCACTGGGAATGCCCACGGGGACGTAGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTC
TCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCA
TTACCTTTATCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCAT
CAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGGTCCTCGGCATGTAGATCCCCGCCTTCATGGTAACAAAC
TTGCTCATCTTCCGTCTTCGTAGGATCCATCATTGGATCCGAACACCGCGGCCTTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGAATCAGGTACCCTGA
TATCAGGAAGACCAACAGTTGGATCTAGTCGGTCCTCTAACGAGTTTAAGTCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGG
CACTTTATCCAATGGGAAGCCTGGATCCACTCGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTA
TCTAAAGGCCGACTCTGGGGATCGTTCCCCGTCCTGGATCCAACCTCCATTGCTTGGATCTCAACACGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTG
GATATGAAGGCCGATCCACCAAGGGGACAGTTGGCTCCGCCGAGGGCTCCACTTCTCCGAGCGATTCGATCTCGGTAGTCGCCTCGTACACCAGAATCTG
CCATTCTTTGTAGCGGCGGGACCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGT
AATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCAC