Description :
From Genome Similarity Track
Location :
Scaffold_864:586- 2107
Sequence
1521 bases(100 bases per row)
AAGAAAAAGACATGGTCGTTGGTGCCATTGCCCCAAGGTCGAAAGGCAATCGGTTGTCGTTGGGTGTTTCGCATCAAGGAGAACCAAGCGGGAGAGATCG
AGCGGTTCTAGGCACGACTCGTGGCCAAGGGATTTTTGCAGAAGTACGGCATTGACTACGAAGAAACCTTCGCGCCAGTCGCCAAGTTCACGTCGATCAG
GATCCTGCTCAGTCTGGCGGCCAAGTACAATCTGACGGTGCACCAGATGGATGTCAAGACGGCGTTCCTAAATGGCTGCTTGACGAAGATATCTACATGG
TGCAACCGAATGGTTACACGGATGAAGAACATCCTGACCATGTCTGCCATCTCAAGCGCTCGCTCTACGGTCTTAAGCAGTCGCCACGAATGTGGAACCA
GACCATTGACAAGTTCATGCTAGAGCTGGGGTTCAAGAAGTGTGAAGCCGATCACTGCATCTACGTCAAGTGGGATGACCAAGACATGATCTTCGTGGCT
CTCTACGTCGATGATCTGGTCCTCGCCAGTAACAACGACGAGCTGCTCAAGTCGAACGCTTCGACATGACGGACTTGGGTTGCCTCAAGTACTTCCTCGG
TATGGAGATCGATCAAGATGCGACTTCAAGAAATGTGTCGGTGCGTCAGACCAAGTTTGCGAAGGACATCCTGGAGAAGTTTGGCATGGAGAACAGCAAC
CCTGTCAAGACCCCTCAAGACCCAGGACTCAAGGTGACCAAGGCCATGTGCGAAGGAGGATGCAACCATGAAGAGACCATGGCCAAGGTGCCTTATCGCA
ATGCTGTCGGCTGCCTGATGTACCTCATGGTTGGAACTCGACCGGACCTTGCTGCGGCAGTGGGAGTTCTTAGCCAGTTCGCGGCGGACCCGTGTCCCAC
ACACTGGCAAGCACTCAAGCGCGTCTTCCGCTACATTCAAGGTACGAAGACGCACGGCATCGAGTTTCAAGAAACAAGTGAAGAAGGACTCCAAGGCTAC
TCGGATGCGGATTGGGCTGGTGACGTCGAGGCTCGACGCAGTACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATTAGTTGGAGAAGCAAGAAGC
AGCGCACGGTGGCCCTGTCATCGACGGAGGCGGAGTACATGGCGTTAACGGAAGCTGCTCAAGAAGCGATCTGGCTCAAGGCATTCCTGTGTGAGCTCGG
CGAAATGAAGAACGAGGATTCTGTCATGATTTTCGAGGACAATCAAGGGTCGATTGCGCTGGCCAAGAACCCCGAGTTTCACAAGCGCACCAAGCACATC
GACATTCGCTACCACTTCGTGCGCGAGAAGGTTGAAGATGGCCAAGTGGTGTTGCAGTACTGCTCGACGAAGGACATGAAGGCGGATCTGATGACCAAGC
CGATCACCGCGGTGCAGTTCGAATATCTTCGCAACAAGCTGGGTATCAAGCCACCAAGCGCGGTCGAGTCGAGTGGGAGTGTTGTCAAGAAGGCGTCTCG
TCCAGCTTCGGCATACCAGTA