Description :
From Genome Similarity Track
Location :
Scaffold_534:586- 12772
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_534-fgenesh-gene-0.0RNA polymerase II-associated factor 1
Pytve_DAOMBR484maker-pve_contig_534-snap-gene-0.14Glucokinase
Pytve_DAOMBR484maker-pve_contig_534-fgenesh-gene-0.1Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_534-fgenesh-gene-0.6Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_534-snap-gene-0.11Dihydropteridine reductase
Pytve_DAOMBR484maker-pve_contig_534-snap-gene-0.16Transportin

Sequence
12186 bases(100 bases per row)
CGCGCATGATCCTGGAGAGCCACGCGCAGGCGAAGCGCCGGCAGCTGCTCGGCAAGCAGTCCGAGTTCCTCACGACGCTCGAGTTCCGCAACGCGCTGCC
GGACCTGCCGTTCGACACCAAGTTCCTGCGCTACCCGCATGAGAGCGAGCGGTGCGGCCGCGTTTTCACCGCGATTGTGGGGGCCGGCGGCGTGGACTGA
CGCATTGCTGTTTTGACGGTATAGTTTGATCAAGTACAAGCCGAACTCACTCGAGATGGACTACGCGTACGAGGTGCACGAGGACGCGACGCTCGGTCTC
GCGATCGACCTGATCGACCCGGCCAAGTACGAGAGTACGTGCTGTGCTGTTCACTTCTTGATGGCAACGGAATTTTGGGGAGCTAAGTGTGGGTGTTGTG
ACAGCGCCGGCGCGTCCCGAACCGCTCGAGATTGGCGACGAGCAGGCGCTGATGATGAAGGAGGAGCAGACCAAGACTGGCCGCTCCAAGGCGCGACCGG
CAGTCTCGTGGCTGCGCCGCACCGAGTACATGGGAACGGATCTGTACGACGCTGTTCACAAGGTTCGTGGTTGATCTTCGATCGTGGACAGAGTGTGACG
ATGTATAACTGACGGATCTGTGGCGAAATAGTTCAAGAGCGAGGTGGAGATCCAGAGCGCGCTGCGCGAGGGTACCGAGAACGCGCTCGCTGAGATCGTG
CAGTACACGCTGGAGGACCGCGCCGAGGCCTCGTTCCGCGACATTAACGACCCCAAGACGCTCGTGCATCCGTTCAACAAGAAGCTCAAGCCCGCCAAGG
TCTGGGACGTGTTCCCCGACCAGGTGCTGTCGGCCAACAAGTACGCCATCCTGGTACGTCGTTCCAGAGCTGCTTGAGCTTGGTGTTCGCCGTGTTCTGA
TGGTGTGTGTGTTTTACTCGCGGTCAGTCCTACGATATATTGCCGTCGAGTGACATCAAGTCGAAGGGCATTCGCGACCGCGAGGCGCGCGCGCTGCTAT
GCGGCGTGTCCAAGAAGAATGAGGGCGGCGAGTTCATTCAGGGCTCCATCCTGCTGCCAAACGCCTCTGCCGAGGAAGAGGTTCGTGTGGGCAATGAAGA
ATGCGGATGTGGCTGACTGGAGGCTGACAGAGAGAGTGCGTGCGTTTTGCAGAAGAACGTGGAGAAGTTCTCGTACTTCCGCGAGTATCAGCTCTCGATC
AACTCGCTGGAAAGCGTGCGTAGACTGGCTGTTTGCGCGGTCCACATGGGATGTTGCTGGGTTGTTAACCTCGTCGTACTGGTTGTTCCACAGCACGCAA
AGGACGATGCCCAGCACTGTGTGTTCATGTTGGACCCAGAGTCGGATCAGTTCACGTACAGTGAGATCATGCACCGCATTCAGCTCAAGAAGACCAAGGT
ACTATTCGCATCACGCAGGTTTCTGTAGTATTAATGATGACAGTGCTCACACTGGGATGTCCGACAGATTGATGGCGACGAGAAGCGCCGCCGTGGCGCT
CTGGTTCACCGTCGCGACTACTCGGAGGCTGAGGCCGACAGACGGACTGCCATCCAGTTCGAGTACGGCGGAGTGTACGACGAGAGCCTCGACGAGGAGG
TGCACGTGCGAGAGCACAAGCGCCGGCGGTCAAACGAGGCTGGCGGATCGAAGCAAGCGAAGCGTGCATCTTCACCGCCCGACGACGACGAGGAGACCAA
GGCGAGCACGCCGCCGCCGTCGCCTCCCCGTGAGCCAGGAGCCGACAGTCCGGCGATCAGCGGGTCGGATAGTGACAGCGACTAGAACGACGTGATCCCC
GCGACGAGACACTGGCCGTCGCGGTAAGCTGGCGTGCATGGGCTGTTGTTTGCTACTGGAGTTGAACAGATGGATATGCAGACGACAAGTCTATTAACGA
ACACTACATCTACCGTGTTGTCCTCGCGCTCACTTCATATGGCACGCGGCCGCTGCTCCAAGGATGCCCGACTCGTAGCCTGCGCTCGCCTTCTCGATGC
GGACCTGTTTGCATGTGATGGATGAGCTTTATCTCCCTGTCAAAAGTCACGAACGGGAGGACGCACCGGGTTGGGGAACTTGGTCCAGGTGTACTTGTTG
TAAGCGGCCCGCACGCGCTCAAAGTACGCCTCGCCGGCCTCGGCGATACCGCCGGACAGCACGATCAGCTGGAATGGCGAGTCGAGCACAGCTCCGGTCA
GTCGAGCGGGGATCATGCACGATTATACTGGACGAACGCACCTCAGGGTCGAGAATACGGCAGAAGCTGACGCAGGCGAAGCCGAGGTAGTCGGCCGACT
CGTCCATGAGACGCGCGCTCAGAGAGTCGCCTGCCGCGGCGTGCTCGAAGATGAGCTTGACGTTGATCTGCTCGGGCGGGAACGCAGCCAAAGTCGACTC
GGCGCCTAACGACGACAATCCAAATGTGATTAATCGCCGCACCACAAGGCCTTAACGCTTCTGGAAAATGATCATACCTGCACTCAAGTGTTCGCGCGCT
TCGTGCAGCAGCGCACTGGCGGATGCATACGCTTCGAGGCAGCCGCGCTGAGAACACCCGCACTGCCGTCCATTGAGCTCGACGATCTGGCACAGACTTT
GTCGTCAGTGACCTCATTCCACCTAGAATGCTGGCGAGCGAGTTCATTACCATGTGACCGCCTTCGATGGCGTTCGTGCCGCCGCGCACGAGCCGACCGT
CGTCCACGATGCCGAACCCGACACCAGTGCCCAATGCTACACACACCAAAACAACAACAACAACCGTCATCACCACATGGCCTTCACGGAGTATCAATGC
GAACACGTACTGAGCATGAGGAAGTTCTGCACGCCGCTGGCCGAGCCGACCCACTGCTCGGCGCGGATGGCGGCGTCCGCNNNNNNNNNNNNNNNNNNNN
NNGTCGTTGCAGAGCGAGACCTTGGTGCCGATGCGGTCCGCCAGCAGCTGCTGCAGCGGCACACCGCTCCACGTCGGGAAGTTGGCGGCCGCGTGGACAA
TGCCGCCGGGCTGCACCACGCCAGGACAGCCAACACCGACGCCCGCAATATGCTTGATGGCCAGGTCCATCTGGAAACAGCAAGTTGAAGCATCGGGTCA
GCAGGATGCAAGAATGTTTGGCAGACCAGCATCAACGCACGCTTTTCAGCAGCTTGAACAGTAGCAGCGCCGTCAACTCGACCACATGGTGCGGCTCGAG
TTCGCTGGGGACGAGCGCCTGCTGGTCGCGGCCCGTGATGACGCCCGCGGCCGTGACGATGCCGATTTTGACGCTCGTGGCGCCAATGTCGACGCCCGCG
TACAGTCCTGCCGTGTTCGACATGCTGCTGCCAGTGGTGATGAAGGAGGAGGAGGGAGTGGAGCGATGGAAGGCGCCGTCGCTGGTTGATAGAGAAGTGG
ACGGGCAGCGCGGTGGCGCTTGGCGTAGTGTGTCAGAGTTGCCACTCTGTCTCCGCCGCGTGAGCATGCAGCCAGCTCGCATTCAACCTTCCTATATCGA
TGAACGGTTTATTGATATTATTTTCTGTCCTATCATTTGCATTATAATATGCAGGTCTTGATATGGCTCATTTGCCATCCTATTGAATACAACGGGGAAA
CGAACCTGCGGATCATAATACTCGATAGGATGCAAATTGTGTAACCTTGGGCGTGTGTTGAAGAGAACATAGACCCACAAGCTCCGGCCAAGCAAGCGAC
GATGGCGGCGCGCTGGATACCCTCCGACAGGCTGGCGGCGCTCGACACGCCGCCCAACACGGACCGCGTGCGCGCGGCGGACCTGGTACTGGTTGCGAGC
GTGCTGGTGCTGCTCTGCGGCTCCTACATCTACTGTTTGTGCTCGCGCAAGTGGCGAGGAATCAAGAGGCGGCAAAGGCGGGCCGCCGATCGCGAGATCT
TCGTCAAGGACATGGCCGAGCCGCTGCTCGGGCCGCCAGACTACGCGCAACCCCCCACGTTCGAGCCGCGGCCGCCCGCGTACGAGTATCTGCCGTCTGC
GCCGCCCATGTCGCCGTGAAGAGGGAGGGAGGGAGGGAGGAAGGGAGAGCATGTCAAGACGGGCTTTAAATTATGAACACGCCGCCAGTAGATTGATTAG
ACGACGCTATGAATCACGGGGGCACGAGTGGCTAGTCGACTCCTCTTGCCGATCGCGACGGGAGGGCGTGAAGGGGGAGGGGAGCTCTACAACAAGTATG
GCGATGGGGATCACTTGGAAGGCTCGGCGGGAGCGACCGGTGCCGTCGACGGCGGCTCCTCGTCCTTCTCCTCCTCCTCCTCGGCTCCCAGGATCCGCTT
CATGGCCGCCTGGTCCTTCTCCGTCTCGATCTGCTGCAGCGACGGCAGCACGATGCTCTTACGTTGCTGCTTGTGCATCGACAGGATCTGCAGTGGATCT
GCAGTGTCAGGTATGATCGACAGAGATTATTGCGTCGATGCACGCGAGCTTACCTCGGACAAGAGCTGGTAGAGTAGGTCAACCTCGAGCCCCATGGCGA
TCGTCAGTCCCTTCGGGTGCGTCTCCGGGTTCAGTTCGACTGCAAGCACTTGAATGCCTAGCGCTGTCGTGTGGGCGACGTTTGTGATGTCGTCGAATGG
GATCACAGTCGTCGTCGCGAAGAACGGGACCAGCGTCCGGTAGATCAACGCTCTGACAGATTTCGCTCCATTGTCAGCTAATGTCCACTGCAACTCCGCC
AACAAACGATTAAGCATGTGCTACGCACCCATACGTCACGTGAAGCTTGACGGGCATCGTGTTGACCACGCAAGACACGTCGTACAAGAGCACGTCGTTC
CTATGAAACACAAGAGCTATCATAAATATCGACAATCATGCACTCAACCTCGAGTCTTCACGCACCGTTCACCAGCAGTCGAGGCCTTCAGATTCGTTAC
TTCAGCGCCTTCCCTGCTCGAACCCCACAAATACAGAGTTAGTAAGCGATCTTGTACCCAGCATCCAAATCACCTCGTGACGTACGCGTCCATGATGGAT
TCGACCGCGCGCGTCCGCAGCTCTTGCACGGCCTCGACCCGCGCAGTGACCTGCTTCTTCTTTTCCTCGATCTTGGCCTTCACCTTGGCATCCGAGTCGG
TCTTGTACTCCCGCCAGAGATCCTGCACCATGGTCGTAATAACCTCGCAGTACAGCTGCTCGCCCGCCTCGGTTTTGGGTTTGTCGGTCTGTGCAGGCTC
AGAGGTACTCTTCTCTGGGTCGTCAGACTTATCCTCAGGCGAAGCGGCAGGTTCGTCTGCTGCCGCCTGTTCGGTCGGCTTGGTCTCTTCAGGGATGGTC
AGATCACCAGATTCGGCTTCTTTGGCATTCTCCTCGGCAGCAGCATCAGCAGTCGATTGCGATGGCGACGCTGCCTCTGTCAGGGTGATGCCGTGCTTCT
TTAGCAAAGGATCCAGCAGGCCGATCAGCAGCGCACACGCGAACTCTTGTTGGTACGCGTACTCTTCCAGTGGAATGCACAGATCCCGCATGTTCAGCTT
CATCTCACTATCCAGTCACAAACTGAGTGAGATCCACCGCCTGATAGGCATAATCAATCGCGATTATTAGCTCAGCTCACCTTGCAAACATGCGCTTGAC
GTCCCGCACGTAGCCAGGGTCGAGCTCTGCCTGTTCAACTACACACACATCATCCACGGTCAGCCTCATTGGTGTCGTGTCGCAGTCACCGAAATGTGTT
CGGACCTGCATCCATCGAGTTCTCCGGCGTCGACATGTACAGGTGGCTGAGCGTGAGGCACTGCGCGATAATCGTGGCCTGGAGCGCGCCGAGCAGCTGG
TCGAGCGCGAACTGCAGCGTGCGCATGTACTCTTGCTGCACGACGAAGGGCACCTGGCGAGTCGTGTTCACCAGTCCGCCCAGCAGCTTGTTCTCGCCCG
ACACGAGCGTGCAGATATGGACCACGCGCAGCTTGGACGGCGACACGCCGATGCGCACGAACACGTTCTGGAACGTGGCCGAGTTGGCCATGCCGCGCGC
GAGCGACTCCTGCGCCACCTTGCGGCGGAACAGCACGCTGTTGGCGTTCTCCTCGGCCAGCACGAGCCCTTTGCTCATGCACACGGTGCCGATGAGCTCC
TTCATGACGTCCCACGCGCGGTCGGGCCGGATCTGCACCTCCAGGATCGTCCACTTGCTCGCGTCCTTGTCCACAGGCATGATGGTGAGCCACGTGGGGA
CCGCGAGCGGGTCGCTGCTGCCGACCGCCGCGCGCACGGCCTCCGGCCGCAGGAAGCGGAAGTCCGGGTGGTCCTGCACGGCGCTGCGCGCCTCTTGCTC
CATCGGGTCCGTCTCGCGCAGTGCCGTCTTGTCCATGCCGAACTCCTCCTCCTCGTTCATGGTGTCCACTCCGGCTCGGGTTCTCGGTTTCCGCCGGTTT
GGCTGCTTTCTTTGACATGGCGGATCTTGTTCACGTGGCCCACGCTATTTTGTAGATGTGAGAAATGACGTGGCCAACACTAGGTTCAATTTCTGGCGAA
TCAAAAGCGTGCACAAGCGCAGCGATGGCCGAGGTGAAGCAAGTGGAGACGAGCGAGCGGTGGAAGGCGCAGCGGCTCGCAAAGACGCTGGATGGAGAGG
TTGCGAATAGTAGGCGTATATCTATCTATGGACAGTGGCGCTAATCAGTTGCGGCTGTGTCAAGATCCGCGAGCTCAAGGTCGCCCTGAGCGAGCTCGAC
TCGGTGCGACCCAACAAGGTGATCTGCCAGCCATTCACGGAGACAAGGTTGGCGCGCCATTTGAACTCACGGAGCTTGCGTTTAGGCCACGTACGTCCGG
CGTGCAGGTGTCTTCTTCCTCGACAAGCACGACGCCATCGTCAAGGCGAAGCAAGGCAAGCGCACCGTCGTTTTCCTTTTCATAACAGCCGCGTCTCAAC
ATGATGATGACGCTTCGCTTGTGTCAAACCAGGCGAGATCAAGACCAAGGAGCGCCAGCGCCGCGAGGTCGGAATGCAGCTTCGCCCCGTCGGTTCGCAG
CTCTAGCTCCGTGTCGTGGAGCAAGTCATTGTCGCCGTCACCGACTGCGACTCCCAGTGTCCATGAAATACACAGATATCATCCTTCTTTTCATTCGCAG
CGCTTCAACACGATTCTGCTTCGAGCACGGCTCGACGATGCGATTCAGCATTTTGACTGGTGTACAGTATGTCGTCAGAGTGTTGGTCGTACCGAAAGTT
CAAGCGGCTCCGCGCCACCGCCCACAATCCAAACAGAGCCACGATGGCCAAGAAGCTGCTCGTCGTCGGCGGCGCCGGCGCGCTCGGCCGCGGCCTCATG
TCCCGCTTCACGCGCGCCTCGTGGGCGGCGCTGTCCGTTGACTACGTGTACGTGCTCGTGTTCGTCGTGGGCCGGCTCATGTGGGACAAGATACCTGACC
GATCGATGTGTGCATTCCAGCCCGAACCAAGAAGTAGACGACGCGGACAACGTCGTGCTCATCGATGGTGCCAGCGCACTCGTTCAGGCCGCCGACGTGC
TGGAGCGTGTGAGTAGCAGTGTGGGCAACCTGGATGCGGTGGTGTGTGCCGCGGGTGGCTGGGCGGGTGGAAGCATCCGCGACGGCGATGCGCTCGCGAA
CATTACGAAGATGCACGCAATGAACATCGAGTCTGCCGTTCTCGGTGCGTGTGGTGTCCATCCTGTGGTGTGACAGAGCAATGACAGTGAGCTGACGTGC
TTTGCGGTCCAGCGGCCCACCTGGCGAGTCGTCTGCTTGTCCCTGGCGGGTTGCTCGTCTTGACTGGCGCAGCCGCAGCATTGCAAGGTGTGTGTCGACC
CTGTTCAATTCGCACAACATAGCATTAACATGTCAGTGTGCGCGATAATGACAACTCACCAGCGACGCCTGGGATGGTGGCGTACGGCATGAGCAAGGCT
GCGACGCATCACTTGGTCGCCAGCACCGTGTACGTTCGCTTGGTTCGTCGTCGTCGGCTGCTCTTGGCTTACCTGACCTATCGGTGCTTCACAGTGACGA
GCTGCCTTCAGATGCCTCAGCGCTGGCGGTGCTGCCCGTCACGATCGACACGCCGATGAACCGCAAGTTCATGGCGGACGCCGACTTCTCCACTTGGACC
AAGGTAACCAATCAAAACTCCACGAGACTCGACGCCATCAATCATCTCGCTGATCACACTTGAATCGCCATACTTGAACAGGTGGATGACATCGCCAGCA
AAGTGCTCGAGTGGGCCGAGAAGCGCGATGGTCGACCGCCGAGCGGCCATCTGATCCAAGTCACGACGCACAACGGCGTATCGTCGTGGGAAGACATGCG
CAATCCCTTTCTCCCATGAGATGGATGACCGTTGATCTCCAGTACGGACATAGCTCCTGAATGGTTTGGTTTGTATGGAGCTATTTCGACATCTCGTTCG
CACAATCGCATTGCGCATTTTTCGTCTTTTTGGCTTTGGTGTGGTGATCGAGTTTTGGTGGTGGTTTGGCGCAATGATGTGTGGGTGGGTTTGTTCGTTC
GTTCGTTCGCTTGTTGCTCATGTATACATACTTCCCCTCTCGATTTGATCTCGTCCGCCACGAGCTCCCGTTCGTTCCGTTCCGTGTGACCCAGTGGTCA
CACTTTGCAGTCGCCCGGCGCCATCGCCATTGCGGCATCTGCCAGATTCCGGCGGAAATGATCGCAGAACGCGCCGAGGACACGCTTGAACTTGCGCGAA
TTCTCGATGCACTCCTTCTTGGAAATCGTGTCCGCGAACTCCCCGCGGAAGCGCGCCGCCACGTGCAACCCCAAGTACCCATCGTCCGCTAGCAGTCGCC
GCAGCAGCTCCTCGCTCCGGTGCTGGCCGAAAAACGCCCAGCAAGAGCGCACCACTTCGGCGATCTTGTCGAGCAACGTCGGCGGCATCCCGCCAGNNNN
NNNNNNNGCGTTGAATAGTCCCGCCAGCAAATGGTACTGCATATCCTTCTCGAAGAACAGCGTCTGGATCAGCTGATGCAGCAGCAGCTTGCCGGCAAAC
TCGGGACCGTGCACCAAGTGGACGGGTGTGCGCAAGATCACCCCGTACTGCGATCCTAGATCCTGCAAGAAGTCGAGTGTCGCTGCGCCGACATCAGGAT
TCTGCGACTTGAGCGCATGCAGCACGAGCGCCAGCACCGATTCAAGCTGGTTCGAGTGCACCAGGATGGACGGGTGGTGATCGCCAACACTCGACACCAG
TTCCAGAAGCGCAATTACGAGCGTCGGGCTCTCGTCGATGCTCCCGTCTGCCGCGATCTTCTGCAACGACCGCTCCACGACGATGGCCACTACGCGCGTG
AGACTTTCGGCCGTCGCCTCGTCGTCGCCAGCGCAGGATAGAATACTCTTGATCACGCGCAGGTAGTTGCCGTCACAGCTTTGTGCAAACTGCGCAAGCA
GCGTTGGCATGATCTGCGACGCCATCTCAAGCGACTGGGACCTCAGACTGTCGAAGATCCCAACGAGGAGCGAGCAGAACTTGTCCACCAACTCCTCCGA
ACCACCGTAGACCCCCAAAATGACCTCGAACATATCCCACCGGCTCTGGAGCTCGATAAGGACGGGATGCTGAATATCCTGGTCAATACGCGGCGGTATT
TGGGTAGCCAGTCGTTGCAAATGGTCGATCAGCTCGATGAGAAACTCCACCGAGCTATCGTCCGCCGCGTTCAGTGTCGGGTATCGCGTCTTGAGGTCCT
CAAACATGATCGTGACTAGCTCCTTGACGATGGGGTGTGCATCCATGTAGCCCACTGTCGCTAGAACTTGCGAGATTGAGTCGACGACCAACCGCAGACT
CTCCATCCCGAGGACAGCTGCCGGTGTACCAGCAGCCATTCGATTCACACGGTACAAGTGCAGAATCGACTCCATCCACTGCTTGTTGAAGAAATGCTCG
CCGCACCTGGCCGTCAGTTTCTTCAATGCCACCGCACCGACGTGGTCTTCTTGTCCGCGCGTACGGAACGGGAACTGTGGATCTGCCTCTGAGATCTCGA
AACTGTTCGACAGGATGAGGAATGCAAATTGATTCAGGAAGACGGGGTGGCGCGCGAACCAATGGCCAGTGACGCCAAGGAACACGGTTATAGTGCGGGC
GAGCGCGCGATGCGAGGGCTCCTTCTTCGACAAATACTCAAAGAGCCGCGGGATCAACGAAGTGTCGGCCTCTCGGATCGACTTCGACACTGCACTGAGA
GCGTGGACGTACACCTCCGTCTTGCGCCACCACTGCAAACAATCGAAAGCGCTATCAGCATCACACACCGCGTCAATCATGATACACAAGCATCAATACG
TACATCCAGCGAGACGGACCCTGCCGCCGCTAGTTCGTACTGCTGGAAGATCACGTGGATCGCGTCGACGATGAACTTGTCTTCGCTGGCTACAGTCACA
GTCGCGAGCGCGCGGAACACGCAGCGCACATCGTTTCGATACCCGTTGAACCGCTCCTTCTCAGCGTCAGGGAAGCTCTCGAAGTTCGCCGGGTACTCGG
TGCGATCGATCAAGATGCGAAGCAGCCGCGAGATGAATTCCTCGAACGCGAACATTCGCTCCTCGTGTTTGCCCGACACGTACGCACGAAAGTCGATCCA
GAAATCCATCGTCTCGTTCGATATCGCCAAGTCGTTCAGCGCAGTGAAGTACAGGATCGTGTCGAGGAACTCGTAGACCAGTGTCCCAACTTTCATATCG
AGGGTGTAATCGACGAAGTATCGGATGAACGACTGGCCGCACTCAGCGATGGCGGTCGCACACCCCGCGAGACAGAACGACACGTCGTTCTCTGGAGTTC
TCATGCGTTCCATGATGTGCTTGCCGAGCACGACAAAGTTCTTCATCACGACCTCCATGAGCGGCACATGCGCGTCGTGTTGGCACGCGCTGACCACCTC
ACGGATGACGAGGAGAGCGTCTTCAGCGCACACTGGCGTCAGCGTCTCTTGGAACGCGCGGTCGAGCAGCCCTGACTCCATGATCAGTCCCGGCGAGACC
GTGCCATACTCGACCCAACTCCGGAACGCCTGCAGCAGCAGTCCGCGCAGACGAACTTGGTCTGCGCTCGCATCGATCGCTGTCGCGAGAGTTGGGAGGA
CGTTCTGGATCACGTGAGCCGCCGACTGGAGCACCATGGTCTCGCAATGCGCGCGCTTGACCTTGGAGAACTTGACGCGCTTGTTGTGCACTTCCTCGGG
AATGACCTTGAGCGCCAGCAGCACGGCAAAGTTGGTTCGGTGCGACGACACACTGTCTGCCACGGGACTCTCCTGGTTTTGCACGAGCCACTCGACGGCG
CCGATGATCGACTCGCTCTGCTGCTCGTGGAAGCGCAGCAGCACGACCGCGATCGTGAGCGCCATGTGGTTCTGCACGCTGAGCTCCTCCGTCGCGGCTT
GCGGACCCGTCAAGATGTTCCACAGCTCATGGCACACGAGGTTGAACTCCTTGGCGACCCGCACATGCTCTGCACGCTCCTCCGCGGTCCAGCTCGCGGG
ATCCTCGAGCTTATACCGGCGAATGTACGATGCCGCCGAGTAGTAGAGCGTCGAAGCGGCGAACCCGCGCTCAGTCTTGGCCAGCGCGTCCCGTCGAGCG
TCGCCCGTCGCGACCAGAGGAGTCTGCAGCACGCGCAGCGCCGCCGGTGCCGCCTCGGGCGAGCGCTGGAACTGCTGCAGCAGCGAGTCGGCGCGGCGTC
GTGCGCGCGGCGTGCTGTGCGGACTGTACAAGTCATGGAGCGCCGTGGAGACCGCGAGCGCGCTCATGGTGCGCGGTTCGTCCAGCGCGAAGAGATCTCG
GAGGGAAGGTCGGCTCTGTGGACGATGCTGGAAAAGGGACAGCTCGGCAGTCGCGCAGCCAAATGCGGCGCTTCAGAATGGTGCGATGAGACTCGTCCAG
ACTTGAACAGCCTCAATCGGTTAATTGCGGCTGGCGACCTTCGCTCGCGAGAGCCAAAAACAGAAGGGTCCCCAAATTAACTGCAAGAAGCCCAAAATAG
ATTACCACGTACCGTGCAGCACCGTAAAAGAGCGCTCATTTTCGTTCGATCCTCGCTGGCTCCAGATCCAGCGCGCACGCGGCTCATTTTCCTCCGCCGA
CCCGGAAACGCCTGACGAGAGCGGGCGACTTGGTGCGTTTCCCCCTCTGGCTGCTCCCCCCTCCGTCCACTCCTCTTCCTCGCGGC