Description :
From Genome Similarity Track
Location :
Scaffold_12:58595- 59877
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04582Hypothetical protein
Sappa_CBS223.65SPRG_04583G-protein beta WD-40 repeat domain containing protein

Sequence
1282 bases(100 bases per row)
CACGGAGACGAGGCCCGCGCTACGCAGATGTATAATCGTCGTAACTCGACATATTACGAGTTGATACCTGTCGCTCACGGCGAGCAAGGTGACGTTGTCG
ATGGCAAAGTCCCCGCTTGTCTTGCGCGTCGGGTCCATGAACACGGGGTAAAACTCGCTAGGTGAAGGCGTGAACATCGAGGAGCAAGGGTACAAGCCGT
GTCCTACAAGGCGCAGCGGGTCGAGCAGGATGCCCGCGAGAGGTCGGCGATCGCAAAGCCGCCGAGACCAAACAGTGCCACGTCACCGCAGAGCGACTTG
CGCACTTCGCCCACCGTGCAGAGTGGCGAGTGCACCATGAGGTGGCTACGCAAGCACCCCTTGTAAAGAAAAGAGGCGCCTTGGGTGGCGTACCAGGCGT
TGTGCGCGGGCAGTTTGCGAATGTCGAGGAAGGCGAGGTGCCCCTTTTCGTACGCCAAGACCACGTCGTGCTCGGACACATACTCGTGGGCGTAGAGACC
CCCCGTGACCTCAAAGCGCTAGGTCAGATATAACACTAAGAACGTGGACGACATCGGCACGGTACAAAGAGCGAGGGCGACGCCACGTTGAGCTGCCCCG
ACGCCGACTTGACGCGAATGTCGGCCATGCTAAACGCGCCGCCGTCCGTCGTCCAGCTCACGCGGTGCGCGGTGCCTAGTCGATGGAATGACGAAATGAT
GCTGGAGAGGATGGCCCAACCGTCAGGGATCCAGCGCAGGCTGCTCACGACGTCGCGCGCGTCAAATTTGAGGACAACGTCCGCGCGGTCGAGGTCCGTC
ATGCACACCGTCTCGTCAAAGCCTACGAGTTCGCTGCGTCTCCTTCCACGTGGAGAGAGGCGACGTACCGCCCGAGAGAACCTGTCGCGGGTGGGCGGGG
CACACGGCGAGCTCGCGGATCAGATTCGAGTGCGTCATCGTGATGGGTGCTAGGACGTCAATCAAGAACAGTGGTCTCGAGCCTAGGATGCACCTTCGAG
ATGGCACTCGGCGGCGGTGGTGCCGACGCGCAGTACTTGGAGGTCCTTGCCAACCGCGAGGACGATCGCGTGGGGCTCGACCCACTGCAGGTCACGGACC
GCCTACACGAAATCGGTGCACGAACATGCAAAGCACGTGTATGTACGTGGCGCAACGGCACAAACCCATTGTCAGGGGACCGAAAGTTGGAGAGGAAGAG
CCCGTGCTCGGTCGCAAACGAGTCATTCGGACTCGCCTCCGAGCCGACGACGAGGAGGCCATCGTGGCGAATCGCGGGCTTG