Description :
From Genome Similarity Track
Location :
Scaffold_103:58591- 61763
Transcript NameFunction/comments
Hyaar_Emoy2809516hypothetical protein

Sequence
3172 bases(100 bases per row)
ACTGCTGGTCGTGTGAAGAATTTTCACGCGACCACACCCAACCTCTCCTCAACTCGGCCAATACAGACATAAACCTCAAGTCACCTGGAAGAGTGCGACC
CGCCCGCCGACGGGTACAAGGTGAGAAGGAACAAGACAAGACATACGGTTCGGAGTATCCCCTCCGTTAGTCGGTCGTCCGGGCACCAGTTGAGGTTTTG
TTACACATCAGTAATTTTTTGATAACTACTCAACCACAATGGTGCGCGTGCCCGGATCTTCTGATGACTTGGGATTTCACCGTGAATCCTAGAGCAAAGA
TGTAAATAGGTCAAGGTTGAACCGGGGATGGAAGTGTCAGCCAAGAAGGGATCGTCGCAGATACGTGATCATCAAGGTCCTCGGTTCGTAAGCGTTCTGG
GTTGAGCTCTGGTGAAACGAAAATTAAATAGAGAGATCAATTGGTGATCATGAAGAAAAACACATATTTCTCCTGAGTTTCCTTCGGGGACCACCACGGA
TCTCACTGCAAACGGCTACCCTCTAGACTGAGCACGTCCAGCCAGAGCAGGACATGTTTCGTCTAAAAACAAAACTTTATACAAAGAACAAAGACCGAAA
TCTGCAGCTCAGAAGATACAGGCGCCTGAATCTGAAGGCGATGATCATGAAACGGGTGCAGGAGAAGAGGTCAAGGTGAAAGGCTGGAAGTTTGATCATC
TACAGCGACGTTTGTAATAGGACCAGCTTCAAAACTTACTGTCCATAGATCTGGTGCTTACGATTCTGAAACCAGAGCTTATCGGACCGAGATGAGGCCC
TGCGATTAAAACAACAGCCGCGGCTAACAAGATGTAGGTGGTACAACGTCTCGTCAGTTGCTACAAGGCGCAGGGTTTGTGCCGGAGGCGTTCAATGCGC
AGGTTCTGCTTGACTGCGACATGGGTCGGGTGATCACTGCCAGTCGATCACGGCTCAAAGCGCTGGCCCCACTTATCGGTAATTATGACTCGGCCGAACG
CGAACTCACGACCACCGAGAAGGTCGAAGATGAAGAAAATTCTCCGGCTTTGTTGTCGCACTATGCTTCTGCTGAGCCGGATGCGGATAAAAGCGATTAC
ATGGAAATCAAACGAATGTTATTGGGAACATCTGGAGCAGCACTTTTGCGTGACCACCACCAGCATACCGCTCCGGACACGATTGCGATGGTTTCACCTA
CAACGGAAGTCCTTGCTATGGATGAATCCGACCCGATGCAAATCTACTTTGCAAAAGCCATGGAGAAGTTCTTACGAGACCGACAACGTCGAATTACCCG
TACGGCGCAAATCGTTCGTCCCGCAACTAACCACAATGTGTTTGGGGCGTGTATGCCAGACACCGACATGGAATTAGCCGATTCTCACCACAGTCGCGGC
AACGCGTACAACCATGACGATCTCGACATAGGCGATCTACGACGACTTCAGTTGGCTACTACTGAGGCCACAACTGGAGGGGGTTTCGCCTCGCAACGAA
TTTACATGTCTGCGATTGCCGAGTTAAAAGAATTTTCGGTCCGTGATCACGGTGGTGACCGCGCTAGAGGATGGGTACGCAAGGTCGAGTCATCCTTCCT
GCGTTACCAAGCCCCTGACTCGGAGAAGTGTCTAGTTTTTGGTGATCTGCTAATAAGCCCAGCTCGTAACTGGTACTCTCAGTTGAGTCGATCGACACGC
AATAAGTGGAAAGACTTACTCGAAAGCTCTTTCTTATAATACTATGGCTGCAGCGTTTCCACTGGCCGACAGTATTACCATGCCTGCAAGCGTTCTGATG
AGACTCCGTTGGAATAACTCTATCTACTGAACATTGCTGGAATGCGAGCAAAAACTCATGTGAAAGATGGAAATGTAGCCGGTTGCCGTGACCATTAAAA
ATATTATATCGAGACACTGAACGATCGCGAGATCGCGAAACAACTAACGCTGCTACGATTGGAGGATGTGGATAGATTCTAGAAACGCTGCGTACGTACG
AGCGTATCCAGAAACTTAAAGGCAACACCCCCACCCCGACAATCTCAAGCAAGTTCCGCAAACGATCAACATCATCACATACCCTGACACCATCATTACC
GACCCGAGCCGTGTGTGTGTAATTCACGTGGGAGGAGATGGTACTTTTCGGAATCAGATATAAGCAGTTCAGACTCAGATGAAGGACAACGACGTGTTTA
CATTGCTACTTCGACCTATCAAGAGACGACTCAAACAAGAGAACGTCCAACCAAGCCAATATCTACTGATCGTGAGCATGATCAAAATCATGCGGTGGGG
CACAAGCCGTGGACTCACTGTGGGTCAAAAAGACATGATGATCGTGGATGCTGGAAACGGTTGACGTTTCAGAAGTGAGGAAGCCCCGGTCATCCCTCCA
ACAAATGTTTCTACGGGTGTGCGGCCTGTGGAGAAGCGCACGAAGGAGGAAAGTTCTCGATGGAAAAGTTTTATAGAATGCTCCGCAAGTGTTACCTACC
GACCAAACATGCCGAAATGCTTCCACCCGACGATGAAAAGATGTTAAAACATGACGCTCGCCAGGATGTGACCTGGTACGAGCCGAGCATTCTAGGCTAT
TCATATACATATTCATTGAGAAAGTAAAGGTGCATAACAGTGTTAATCGCCTGAACAGAAGGAATTTTAGTACATGTGGTCGAGATGCCTGTGTTTGCCT
TCAATTGCAAGTATGAGTCGACCGGATGCATATGCACGATCACCTACCAAAATGGAACTCAAGTTGTCTCCTGGAGAATCACTTGTGGTTACTGGAAGTA
TCATACTCCAAACAATTGGTCACCCTACTGTTTGAATTGGGAGCTAAAGTCTCGATAATCGACACCACCTTTGCTCGTAAGGTTGGCTGTGTCATAGATG
AGATCATAACCAAGAATATGTGGGTATTGGAGAGAATTCATTCAGTCCGAAGTCCGCACGAAGGTGAAGACCACGTTAAACGGGCCCATAGTCTATTACT
TAGGTGTATGGGTCGGTGACCAAGCAGAGCAAGAGGCGATTCTGGGAATGGACTTTATGGAACCGGCCTAAATGCGCCTTGACCTAACTGACGGGACAGT
CTTTTTGCCGGAAGAGGTCAAGACTCAACTGGTAGTTAGAAGACCACCGTATGGGGCGAAGATGCAACAGAT