Description :
From Genome Similarity Track
Location :
Scaffold_1542:5859- 7363
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1542-fgenesh-gene-0.3SNARE protein
Pytar_ATCC12531maker-par_contig_1542-fgenesh-gene-0.1Mitochondrial Protein Translocase (MPT) Family

Sequence
1504 bases(100 bases per row)
CTTTCTAGCTGCCAGCGAGAAGCAGGAAAATGAGGATCACAAAGAGGATGAGGATGATGACGTAGAGTTTGAAGTTGCTGCTGTTTCTCGCGACCTACGT
CACCACCACAACCCGTCAGAACCTTGGCCAAACAGATGAGGATCAGAATCATTACCTGAGCAGCTCGCGCTCCTTCGGTCTCAAGACCGTCCGTCGCGCG
CGACACGTCCGTGTCGATGTCATCAAGGAGACGCACGTGGAGCTCCGTCTCGTTCTTCATGGTCGTGCTGTAGTTCTTCAAGTTGGTCACGCCCTTGCTG
ATAAAGTCGAGCTGTTGGTCTTGATCTGTGTTACCACCACCCAGCCACCACATATCAGCTCTGGTGTGTAGAGANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCACTGACCTTTCATGATCTGGTTCTGCATGGTGAGTAGCTTGCCAGCTTGGTCACGGGGCATGTTGCCGCTGGAAAAGGAACATCC
ATGTCAGTTCTTGCAGGCTCATGCTGAAGACAAGACATCGAAAACACACTGCGAGTTCCCGCCCGTAGCGTTGCGCTTATTGTAGAGATCCATATCAGTT
TTCTGCAAACGATTAAACGGTGAGGTTCTCTCCCAAATGGCGATGCTGGCAGAGGTAATTCATCGTACCTGGTCGTGCGCTAGCTGGTCCAGCAAGCGCT
CACGACGAGTCATCTCGTGTTTCGTACTACACAAACTCAACCGTGAGCTCACAACCACCAGTTAGAAAATACTACATAGGAACGCACACGACGGAGCCCG
ACGACCGCTTGAGCTGGTCGAAGTCGCGCTTGAGCCGCGTCACGGTCTGCTGCATCGCGAACACGCTCGTGCCCACGGCCGCGCCATTGCCCGAACGGAT
CTTGTTCGACACGGAGCTCTGCTGCGTGCGCGCGCCCTCGAGGCGGTCGAGCCACGACGACCACGCGGCTGTGCTCATGGTTCACCAATGGGATCTTTTG
GCTTGATCTTCCACCGTTGTGGTGGCAGCTTCTTTCACTTCGCTTCCAGGAAATAGGGGCTACTATTAGAGGGCCTTACTTCGTCCCTCGTTTCGATTTT
TGCGTAAGGGATTGTCAGTCCCTTGTAGGGGTGGTGGCGTGATTTCAATGAGGGACTGTGGCGCGCTTGGCTGTCGGGAATCGGCATCATCAAGGACACC
CGAAGCAGCCCTCGACGCCGTCACCATGAGCCAGCGCGACTTTGAACGCAAGATGGAGGAGCACATCGAGGAGATGCGCCTGACGCAGACCATCTCGTAC
TTCAGCCGCACGGTCGAGCTGTGCTTCAACGAGTGCGTGCACTCGTTCCGCAGTAAGAAGCTCGACGACAAGGAGCTCTCGTGTGTCAGCAGCTGCGCCG
AAAAGTTCCTGCGCCACACGATGCGGTCGTCCGTGCGACTGCAGGAGAGCTACGCGGACATCATCCAACAGCAAGAGGCCGCGCAGCAGCAGAAGTAAAT
ACAG