Description :
From Genome Similarity Track
Location :
Scaffold_10:585769- 587353
Transcript NameFunction/comments
Physo_448800Hypothetical protein

Sequence
1584 bases(100 bases per row)
CTGCTCGGGCGTTGTAATAACTGCACTGCTGCTCAGTTGAAGCCCACCGAACATATCCGTGGAAACCTCCGTCGTGGCAGGTTCCGCCGGCGCCGTAGTT
TCGCCGACTGCACTGTTACTCAATTGAAGGCCACCAAACATGTCGGCAGGAGCAGACTCCTCTGGTGCAGACAATGCGACATCAACCGCACCGGAGCTCA
GCTGCAGTCCACTGAACATGCTTCCACTATCGGCAGGAGCATCAGCGCCCTCGCTTTCGGTGACAGCCACGTCCTGTTCCTCCTCTTCTGCTGCCTTCTC
GGCCGACGAGAAGGAAGAGGTGCTAGCCTCGAAGTTACCACTCAGCTGCAGACCGCCGAACAGAGATCCAGAAGCTGAAGGAGCGATCAAACTGGCGCTG
TGGTCAGGTACCGTGGGGGTCCCAAAGAAAGAGTCCTTCATATCCGACGACGTGGGCGAAGCGACTTCAACCTTAGCCGGGGCTGCCGTTTCCTCAGCCT
CCTCCACTTCAACATCGGGCTCTGTAGTCGGAACCGAACTCTCAGAAGCCGCGGCGGGGCCACCGCTCATCTGCAGTCCACCGAAAAGAGAACCGCTCGT
GGATGGCTGAGCAACCTCCTCCTTGGGAGACTCATGCCCCTCCGATCCTTGCGACGCGTGGCTTCCCTCAGACCCAGAGCCGGAAGGCTTGATGTCGAGG
CCTCCAAACATGCTCGCACCAGTCACACCGCTGATAGTGTTGCCGGCACCCAGCTGAGCGCGAATGTTCTCCTCCTCTACTCGCAATGACTCCAGTTCCT
CGTCATAGGCCGCTGCCGTGTCGTAATCCTCGTTTTCGGTCGCCAACTCGATTTGCTTTTCGAGCATCACAACGCGCAGATGGATTGTCTCCAAGGACTG
AGTCAGCTCATCGTGACTTCGTACAGCGCTCACGGGGCTAACCATTTCCTCGTGAACATACTCCGCCTCAGCTGCTTCCTCCTCCTCCACAGCAGAGTAC
TCGCGATCATTGGATTCTTCGGCAGGATCCTCCACCGAGCCGTCATCATGAACATCATCGGACGCAACCTGCGAGATTGACGCCTCGATGGCCTGCTGAC
GCTGCTTCAAGGTTTCAATCTTTTCATCCAGTCTGGCAGCCAACTCATAATCCTCGTTCTCGGTAGCCTTGTCAATCTGGGACTCGAACTCAGCCAGTTG
GGCCGCGATCTCCTCCAACGTAGAGCTGCAGTCTTCGAGAGCTTCGACATCAACATCCGATCCATCGATGTCCGTCGCTTTACCCGTCAAACTCGAGCGC
GAAACTGATACATGATCACTGCCCTCGATCTCTTCATCATAAATGGATTCATCGTCGTCATCATCGTCATCCACCTCTTCGTCCTTCGTAGGGTCGCTCA
CATCATACTTCTTCTCCAGCGTCTCCACTTGAAGCACGCACGCATCGTACTCGGCCTGGACCAGCAACATCGCCGAAGATCGGAAGTCGATACCGTCGTT
TGCAGCATCGCCCTCGCTCTTGCACTTTTCGATCTTCCGCAGAGCTGTGCGCAAATGCTTCGCTTCCTTCCACAACTCCTGTAG