Description :
From Genome Similarity Track
Location :
scaffold_1:58554- 60427
Sequence
1873 bases(100 bases per row)
TCCCAGACAAGGTGTCAAACGAATTGTCATCTGCCAGAGGcattcgtcatgagattgacatacATCCAGAAATAAAGCATTGTATCACACGGCGGTTGTC
GTTGCCAAAAAAATAATTCATTGCAATCAACGAGTTCTTTGCACAGCGTAAGAAGGCTGGTCATGTGCTGGAGAGCAAGACTTTGCATTGCAGCCCAACC
ATCTGTGTGTAGAGAGCCACAGGAGGTTGGCGAATCGTTTACAAATTAAACGGTACAACCATCCTGCCCAGACTCCGGTTTCGCGCAAAAATTTGATCCT
CGATGGAATGATGTACAGTGCTGTTTTTGGTGCGATTAATCTGGTTAGTACTTTCATCAGATACGAATGCGCGAAAATAATACACCATGAACTGCAACAA
ATACTTCcagtggtatgctgtggGTTGATTAGTGATGCCATAAGATTTGAAGAACGCCCTCGCAACTTTCAACAGAATGGTCACGAATCTACTTCGTCCA
TTGGAAGAGTTTCCCCGAGCTACTTCGACCATATGTATGTTTATAGTTAGAAAACAAAAGAGAAGTCTGATCtcgatgttcatcttgatcatggTCAAGT
TCTTCCAGTTGTGCGAGAGATTAAACCGTAAGCTAAACTGAAACAGTACGTTTTTCTTCCACCGAAGATCCCCGTTCTCGCTGCTTTCTGGGCAAGAATA
ACATTTGTATGGATTCGGAGAAAGTCAAAGCAATCAATGATTGGCCTGTGTCAAACAACTGAGACGATGATTGGGCTTAGCCAATTATTTACACAAACAG
ACGCGCAATTATGCAGCGTTAGTACAATTCCTGACGacttttttaaaaagaaaattgaGTTCGAATGGTCAGAGGATCACCATGCGGTATATGCCGAAGT
AAAAATGATCTTGTGAGAATCTCCAGCGCTTGCGATTGCAAAGCACGTATAGCCTTTTAAATTGGTGTGTGATGCAATTGATTATGCCATCGGTTGAGCG
TTGATGCAACATGATGATAAGGGTCAAGAGAGCGAGTTGTTTCATATTAGTCGCGACAATATCAGAAATTATTCAATTCATGACAAAGAATCTATAGCAG
TGATGTATGCTTTGGGTAAGTTTCATGTGTACTTGCTTGGAGAGGAGCACATTGCGATCTATATAGATCATGCCCTACTGCGTACGGCAGTAAAAACCCT
CATTTTTTGCGAATTATGGCTCGATGGCTTTCCTTTTTTGCGATGTTTAATTTGGTTATATACCACAAGCCAGACTGTACGAGCACCGTTACCGATGCGT
TATCAGGATGTCAGGACTATTATTTAAAGTCCAGGAGCGAAAACATGCACGAGTCGTGTCGACAATGCGAAGATGTTCAGACGATCAGAGTGCAAGCAAC
GATTATAGTGCGCGAAGAAGTTGTCAAAGGGTACAAGTCTTAGCAGGACATGTTGAgatatttcaaaaaatacttccgacaaagcactgcaagaTCTTCC
GACTCGCACAAGATCACGTGTTCAACCTTGTGAGTACACAATAGATTGTTGTACTATGCGGCTGTAACGGGGGTACATCAAGAGTTGTTGTtccaaaaat
gaaaatttgCGTCATCGTCTCTTACATGTGTACCATGACATGTCCATCTGGGACGTGGGAAAACATATCTCATTCTTTCCCGAGATTACTATTAGTCACA
GATGCAAAGGTGGGTGCGCAAATATGTTAGGACTTGTGAAATTTGCTAGAGTGAAACCATCGGGTTcactcagggccactgcggTTGTTAGTAGTGCCAG
TGACAGCTGGAAGTCTGCGAGTATGTACTTTATAATCGCACCCGCGTGACACACATGGACGCAGCGGCATCCT