Description :
From Genome Similarity Track
Location :
scaffold_66:58551- 62325
Transcript NameFunction/comments
Plaha_PHALS_04866spastin and fidgetin-like protein
Plaha_PHALS_04867u4 tri-snrnp-associated

Sequence
3774 bases(100 bases per row)
ATGCGCATTTGGAGTTCCCAGCGGTCAGAGGACGCGTTCCAGAAGACCATCGAGGAAGCCGTAGCAGTGGACAAAGCTGGAAAATACGCGGAAGCAGTGG
ATTTGTATGCGCTGGGTATCGAGAAAATGATGGCGCATCTTGCGCGTACGTAGAACTGGATAAAGCGACATGACCTACTCATTACGAGACATTTGTGTTC
TCTGTGAGCTTAGAGATACCTGACGATGATGCAAAGGCTATTATGCGCGGTAAGATAAACGAGTATATGATGCGCGCTGAGTACTTGAAGGACTGGACTG
CAAAGCAGGCGCGAAAAGAAACTCAGGTCGGCTGTCAACATATGCTCACGAGTTTTATGTTATAATCAAAGTTTTGATATATCGCGTTGAAAGATTTCAT
CTGCAGCTACCACGAGCATTAAAAATGCTCGCGTTGCGAGTGAACGACAGGTCAAAGGACCAAAATGATGAAATTTGCTGAAAATTGACGGTTTcatgtt
ttgtttgttgCAGAAAGCAGGGTACTCGAAACAGCATGCGCAGCTTGCTCATACGATATTAGACGATGTCCTTGACCACTCGCCTGGCGTACATTGGATG
GATATTGCCGGGCTGGAAGTTGCGAAGCAGATTTTGCAGGTTTGAAGGCATAGCCGTATACTTATTGGCCAAATGAAATATGACTGAGTGATTTTCACCT
TCGAGTAGGAGGCCGTCATTTTGCCTACAATGCGTCCGGATTTATTCACAGGCTTACGAGCGCCGCCTCGAGGGGTGCTGTTGTTCGGACCACCCGGCAC
AGGTATCAAATCTTAATTTTGTCTGATTGATAGTACGTGGTATGTGAATGCTGCCTTTCATTTGACGTTTGAAGGAAAAACATTGCTCGCCAAAGCTGTT
GCTACAGAGGCCAAGGCAACCTTTTTCAAGTATGTGCAAGTTATTGTGGATAGTAAGTGTGTAATGTTGACAGATATTTTATATAGTATTTCTGCGTCGT
CCTTAACATCAAAATGGGTTGGAGAAGGTGAGAAATTGGTCAGAGCACTATTCGACATGGCTCGTGAATTGCAGCCATCTGTTGTATTCATGGACGAGAT
GGATGCTTTACTGTCGACAAGGTCAGCATCTGAGAATGATGCTAGTAGAAGAATCAAGAACCAGGTTCGAGATGTAACTTTTCTgtgtgatgatgatgag
ttgAGGCTTTTCTGCTGAACAGTTCTTTACTGAGCTGGATGGAGCTGCttcatcacaagacgatcgaATTCTTGTCATGGGAGCAACAAATCTTCCGCAG
GAACTCGACGAGGCTATAATTCGGCGTTTGGAAAAGCGCATCTATGGTAATTTTATTCAAGAATCGATATAAACTGCTGCTTTACCGAATTCTAACGGAG
ACGACGTGATACCTGTCAGTGCCCCTACCAGGTCCTTCATCTCGTGAAGGACTTATCCGACATTTACTTCGTAGCCAAAAATCCTCGTTATCGTCAAACG
ACTTTAGGTACATCGTGAAGGCAACAGAAGGATACTCAGGAAGCGATCTTAAGGCTGTTTGCAAGGACGCTGCATTAGGCCCAATTCGTGAGCTTGGAGA
AAAGGTAGCAGACGTGAAGGCTGAAGATGTGCGAGGTATTATTGCATCCGACTTTAGGGTGGCACTGACGCGTGTCCGTCCAAGCGTATCTGCCAGAACG
ATCGATGATCTAATTGCGTGGAACGAGCGATTTGGAGTGTCTGCAGTGTGACGATTCGGGCTATATTTGTTTCTTCCGCTCATAAATCATTAAGTACGAC
TCTGAGACGCCGATGAGCTGTGGCATTGTCTCCTGGACGTGCAGATCTTGAATTTCATACCACTGTTCAGTCGCCTATGACAGACCAAGGTAAATTAAGC
AGAATCCGTTAGTGTATTTGCCAAGCTCGCGAAAACATTGAAGCTGAGTACTCTATTTTGAACATGAACGCGATAGCTGCCCTCCGTCAAAGGATTTGTT
TGTAGAGCAGCCTTTTGACCGGTTGTCACTGGGCTGTCATGGCAAATATTGGCAACTAAGTTATACCTAACGCAAAACATTAGTCTTATAAGAGCGCTAC
GAATGTCAGAAAACGTACTTAGTGCAGGGTAGACGGACACGCGTGATTTTTTCAATCAAGTCGGCCTTTTCAACACAATCCTATTGCAATCAAGCGaggt
atttttttaagatTGAGTAACTTCAAACGCACAGACTTAAGAAAGGCGTACCTTGGTCGATTGATCGAGCTTAAGCAGAATAGCCCGCAGATCTGAAGTT
GTTTTCGTGCGAAGTGATTCCTTGGATGGAAGACTCTGGTCCAGCTTTAAAAAATCTCGCAGCTCCAGATTCTTGACAGGAAAGTTTACGATTGTTGAAT
TCTTCTCAGTGAAGAAGTTGTTTCGTGTGAAGCGCTTAACGTGAAAGATTAAATATGCGGGTAACGAGTCAATTCGATAAGTTTTTTTCAAGCGGTGAGA
ACCTTGCAGAATATGGGTTACGTGGGAACCATCATACTTTTCGAGCACTGTGAACAGCGGAATCTAACCAGCATCATAAGTTAACCTTGCCAAATAGCAA
GAACGACAATTAAACTACGCTGACCTGAGGTATGATGTTTCCACCCTGAGAATCTTTAAACAGTGGCATTGACGGTAAGTCCAGCGCCAACATCCTTACA
GTAAATATGACAGTGAGTGGCACATAAATCAAGCAAGATGATTGTCCTATGCGCCGTACAAAAATGGTGAGATTGATGTGGAGACAGCCGATTCATGATC
TGCTAGATCTGTCGTTGCAACCTTCGTTTCATCATTCGTTGTGACCTCAATGAAACCCTGAAAACACTTATGTATGATGCTGCTTCCTGGCTTATGCGAT
CCACCAAGACCCTACGAAAATACCCACAGTTCCTGTAGGTAAAGGTTTCTAAGTCAATCATTACGCTACAATTGCGGACCTTATGCAGCTCATTCAGCAG
CCACGCCAAGAGTTCGACACTTTCATTTTGTATTCCGACATGAAATCGTTTTTTGCTGCTCACAGAAATCTCCTGCACTAGCTCATGTGGACTGATCTGC
ATGAAGTCACCAACAATCCGCATAAGCAATTACGATGTCAAACATAACTAACAAGCGTACAGTATTTTTAAAGTTGTGTGGGCTCCACATCTTGCGCAAT
AGCTCTCCAAAGCGAAGCACAAGCTTGGACTTGATTTTGCCCATTTTGTTGACCAGAAAAAAGTCTCGCAGTGGTGGTACATGAGCCAACGCCTGTACCA
CTACGTTGATGTAATCTGTGTGCTTCAAATTATTGAGGCCAATGAAACCGGGCAAGTATGATACCCCAAAAGCGTCTTGAGCTAAAATACGATTCTGGTC
CAGCTGAGCAATTTCTGCGGCCTCAAAGCTTGGACGTAGTGCATCTTGTACAGGCTTTAAGGTGTTATCCACAACTTCATAGTTGTCTGGCAGGCAGTAA
ATGCGGTCTGTTTGCAAATTAATAAACACATGATGGCTGCTTTGCACCGAATGCGTGAACGCGTGCGTGTTGTGGCCGCGGCCTTGAAAATATTTGCCGC
ATACGAGGCATGCGTAGACGTTTTGGTCCGACAAACTGATACTACAAACCTTTTCGAAGTCAAAGTCGAGCAGTTGATGATTTATTGTGTCCAGGTACGG
ACATTTACGACGTTTCTGCCCCAAGTTCGCGACCTCGACAGCGTCAGCCTTGCGCTTCATCAGGTTTGATTGAt