Description :
From Genome Similarity Track
Location :
scaffold_149:58544- 60062
Sequence
1518 bases(100 bases per row)
AACATGGAACCATCGCGTATGTGTATGCGATATAAAGCTACTTCGACCTCCTAAATGGTAGCGCCTACAAGTGCATCAACCACATCAAAATCTGGGAAAT
ATCCCTAATAACATCCTGCTTACCGAACGCAGTAGACGTACAACTAGTGACATTTGAATAGGAAGTTTGAAAAGAATGTGGCTTATGGACACCGTCGCCA
CGTGACGATTCTTCGTGAAACCTTTGGTACATTGCAACGCGACTTTATCCTGTAAAATTGGATATCGGGCCACATACATGTACATGTAGTAAAAACAAAC
GAAGTACAATTATCCATCCCACCGCAAGTCCCACACAGGGTGCGTAGGATACCTAGCATCAAGTTTTTCACCAATTTTTATCTTTCATTTTTTTAGATAT
ACTACTGCTATGTCACTGTGGTAAATCTCGACCAAATGCTTTGCAATGCAAACATCTCGCATGGGCTCTTGGTCGATGAATCGGACCAAGAAGCATGCGG
ATCATGCTGAAGGCTCAACATCGTGTCAAATTCGCCCATGAGGAGCGCAAGCTATTCCCGGTGAGGCATCAGACATCCAGAAGCAACAGAAAAAACTTAG
GATAAAACTCCAAAGTACACACGAATTGATAGCGGATCTGAAAAATGTTCTCTAAATTTCGAATATTCTTTAGAGGTGACTGCCAGAAATTGGAGAGATC
GCAAGTGGTTCGAGTTTCAACAGCTCTTGCTCTTCGTTGCGGAGCTGCCGTCGATGCTGAGCTTTTAACAAAGCGCGCAGACTCTCTTGATCGTCTTCAT
TCGAACTCAGTACTTGAGTGACGCACTCAAGCTGCTCCGAAGCATCCAGGTTTGCTACGGAAAAGTAGCTGAAAGCAGGTAGAAGAACAAATTAGTTCGG
GTTCGCTACACGGCACTATAGTTCCGTACCCTGTGTGAGATTTTTGGGATTCTTGGGCTCCAAATTTCTTGAGAAAAACTTCGACTGCCACCTCAACGTA
GTGCTCCCTACGACCAACACCAATAGTTTAGATGCTAGCCTAAGTTAAAATACTTCGACGGTGCTCACCTGGTTCCACAAACGCGAGCCTCTAGGGTCAC
AATATCATCCGTCGTGATAGGCAGCTTAAACCCGATTTGACTGGCAGACACAGTCACCATGTTGCTGTTCGCAGTAAAAAACCTAGCGCAGTACAGCGCT
GTTTTATCCTGATCAGGCAAGATATCACCAGTAAATTACCAGCATTTAGTTCACAAAGTGCATAATGCATCGTACCATCCACGCTAGAATCTCACCGCCG
AAGACAGTTCCGTTCCGGTTCAAATGTCGAGGCAGGAGCGAGGCTGAGAGAGCAACGGCAGTATCCTGTACAGTTACTTCCCCACCACCTCGTGCAGCAT
CATCCAGCATATCCAGCGAAATCTCTGACAATTGATCGACAGCTTCCTCCAGCTTCTTCCGACGTATGGACAGATTCTTGCGCTGTTGTGCAACCTCCCG
AAATCTATCGATTCGGCT