Description :
From Genome Similarity Track
Location :
Scaffold_1194:5854- 9313
Transcript NameFunction/comments
Phyta_totarag12363hypothetical protein

Sequence
3459 bases(100 bases per row)
TTCCGCTCCAGGATCTCGAATGCTTCTTTTGCCCTGTGCAAGTTCTGTCCGGAACGTACTTGTTCGTCCGTAAGTTCATACAGAACGACAGCCACCACCG
GAAAGTCTTCAATGAACTTATGATAGTAGTTCAAACTTCCGAGAAATGACTGGACACCTTTCAAAGTGTTCGGGAATGGTAAGTCCTTCACACTTTTTGC
GATCTTCGGCTTTGCGCGTATTCCCTCTGCGCTGATCTCACGTGACAGGTACGGAATCACCAGCTTTCCAAACTCGCTTTTGGGTAAGCTCACTGATATA
CTCCAGTACCGAAGTCTGAACAGGAGAGCGTTCAAATCCTCACACAACTGATCCCAGGTCTCGGCACCATGAGCCATGTCATCAATATATGAACTTCGTC
CCAGAACAGGACCCATTTGAGACGGCGTAGGGATGTTCCGTTTGAACACTATCATCCGGTCAGTCAGGATTGGAACAGACTATTCTGACTTCTCTCGCTC
TGAATCGTTTCGTTGTGGTGGATCCAGGCCCAAGTATTCCAGCACATTTTGATCCACTTCAGCCTCTTGTTCTGTGGGCAGTCGCACGAAACCCCATAAA
CAATTGTTGATCATGGCCTGATAAACCAAACGAGCATTCTTGAGTCCGAACGGCATGCGTGTCCACTGGAAATGTCCAAATGGGCAGGTAAACGCTAAAA
CCAACTTTTGCTCGTTCAGACATCATAACTGCCCAGAAACCGCTTGCCATGTCGAGACTCATGAACCACATTGCTCGTTCAAAACCAATCAGGAGGTCGT
CGATCAGAGGTAGCGGATAGTTCGATAACTCGATGAAACCATTCACGACCCTGTAATCAATACACATTCAGATGTCTACATCATTATTCTTCAAAACGAT
GGCGACAGGAGAATCCCACGGTGAACTGGAGTGTTCTATCAGACCAGTCTCCAAAAGCTTCGTCAGCAATTCGTACACTTTCATCGCTAGGTGCGGTGCG
ATCGAACGGGGACGTTGCGCAACCGGTTTCGCGTTGTCAACATCCAAATCACATATCACCCCTCGAGCCGGTGCGGGAGTTGCATTTCCATCTCCTAAGA
AAATGGATCGATAGTAGACTTCAGTTTTCGATCTTCGTCCGGAGATGATTTTCCCGGTACACCCACATCTGTTTTGTCGATGTCACAGGTTGGACTCAGA
TCCTGTAGTTCCGGTAACATGACCAACTGATCACGCAACTGAGACAGCAGCTCACTGCCCTCATGGATGTACACCGCTGGTTCCAAAGCCAACTCCTCGG
CATTCACCTTCATAAATCTTTCGTACTCCAATTCGAGCTTTCGGGCCGGCGTCCCCGGCATCGCCCGAACGGAAAGATCTTAcaagtcttcttcgtcaaa
cGTGTCAGACACAGGTATCAGACCATCTTCGTCGAGGCTGATCGCATTAAAGAATTCATCTTCGTCCGAATCGGCGTCTTCGAGCGGATCCCCTCCAGTC
TGCGACCATTCATCACATCGTGGAAGGTCACCTTCACCCGGGTTCGGACTCGTGCCGATGGATTCTTCCCGGAATATCTGCACCTTTAGCGTCTCCTGCT
GGACACGTGTCTGTACGGATCTCATCCTCGGGAGCAACTTTTTTCACAACAACTCCATCCTGATTACCTTCACTCGACCCGACTGTGTCTTTGGTTGACA
CATCTCTGCTCGACTCCTGCGAGATAACATTCGTGAACACGTGAGGCTTTTTCTGCAGTTGCACTATGTGAAGTTCATTGGTTCCAGGCGGAGGTCTTGT
TAGCAGTTTGCTCGGCCAGGGGTAGACGGACGTTTGGACACAGGTGGTTCAGCGTCACTCAAACTCTGTTCGATCTGTATCGCACGTTGTCTGACTCGCA
TGGAGTTGGTGTTCTCGTAAATGAGAGTCTGCCACTCCTGATACCATCGAAGACCCGGACGTACGAATCTCCCGGCCTTCGGGAAGTATCCGAACTCGAT
GATCTTGGCAACTTCCATTTGAGTATCAATGGATAGAAATCTGGTCGAAATATCCACCACCTTCACTGCGACCGGCCAGGATCTCGCACCGTAAATGATC
TATGTCACCCACCTGTCTTCTCGACCAGCCCATACGACTTCACGTTGGGGGTTGCTCTGTCCGTATCGGATTCGCACAATTGCATGGCCGCCTGGACGGA
GGTATAAATCATCTTCTGGTCGTATATATAGATCCAATCCTCGCTCAATGTGGGAACGAGTCCGACCAGACAGCAATACCGTTTCCTCGTCCGGAAGCTG
CACCAATCCTTCTCTAGCACAGAGCCGCACTCTAGCCGAAAATATGAAGTTCATTCCTAACAACACATCCACGCCTTCATCAATGTTGACCACCCAAAGT
TCTAAAATGTAGACCACTCTCGGACCGAGAGTAACCTTCACTTCAGTACTGACGGTAATAATCGTCGGGACACCTCCTAACCCGCACATCCGGAGCTGTT
TGCGAGAGTTCAGCTTGAGTTTGAGCCTACGCGCAAGGTCAAAACTCACCATACTCACTGATGCTCCGGAGTCCAGTAGGATATCCGTACGACGATTGTT
CACCGCACCATGAACCATCGCGATCTTCCGACTCTCGTCTGCTTCGTGATCTTCCCACCATCCATATCGTTCGCCAGGTTCCAACCGGAACTCAATTTGG
GTATCTCAATCAGGAGACTCTAAACTATGACGTTCGGAGCATCTCTGACCGAGGTGTCCCAAACTGGTTTGTTCAGACAATGGAACATCAGTGCCTTGGA
TCACGGTCATGCATTGAAAGTTATCTTGATCTCGATGTCTCAACTCGGGGCCAACGTATACTAAGACACACAATTCTGGTGTTTTCTTGAGCCCGACGCG
TTCTGGATCCCCATCCAGCGGGCTTACAGGTTTAACGGCTTCTCCCCAGAATCAGTGTCTTGGTTCAGAAGTTGTTTCAGGACGGGTGCTGGCAAGTCTT
TCAGAAGTCCTTGGCGGGCGAGAGACTTTAACGCTTGGAGCGCCTTTCCGTCTTCACACTTGCCTTCGTGGAATTTCTCGCAATAGGGACACGGGCGTgt
cctgcagcgtctcgtaGGGTGTCCTCGGCGGCTGCAACGCTCACAAATTAGATCCACCCAACAGTCTTCAGTCACATGGGAACCTTCGCCACGTTTACCA
CAGAACTTTGTCTGGTTCGAACTTCCGAACCTGGGCGACGATGGTCTTACACGGGAATCTCCATTCGGAAGTCTCCAACCGGAATTCTCCATAACGCGGT
AGACGTGACTCGACACTTCCTGTTTCCTGGACACATCTCGTCCGGAAACACCATTGCTTGGAACATCTCCGTTTGGGGTAGCAAGTAACGCTGTCGTTGG
CTCCCTAGCGGGTACTTCCtcgacagcaacttgaaaATGCACCTGCTTCTCGTCTTCCG