Description :
From Genome Similarity Track
Location :
Scaffold_47:58523- 60528
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_47-fgenesh-gene-0.10Myosin

Sequence
2005 bases(100 bases per row)
GGACGTGGTGGAGGACCTGATCCAGCTGCCGCACCTGCACGAGCCGGGTATCTGCCACACGCTGAACGAGCGCTTCAAGATCAACGAGATCTACACGCTG
ACGGGCGAGATCCTGCTGGCCATCAACCCGTTCAAGAACATCGGCATCTACACGGACAAGGTCATGCGCAAGTACATTCGTCACGGCGACAAGCGCGCGC
TGGGCCACGAGCTCGCCGACATGCCGCCGCACGTGTTCAGCATCGCCGACAAGGCGTACCGGTCGCTGATGGGTCCGCTGGCGGGCCGCCNNNNNNNNNN
ATCCTGGTGAGTGGCGAGTCCGGCGCGGGCAAGACCGAGTCGACCAAGTTCGTGATGGAGTACCTCGCGACCATCTCGCAGGCGAACCACCACCACCACC
GGCGGTCGAGCGCGGCTGTGGGNNNNNNNNNNCGAGCGACGGCGACACGCACGTGATGCAGCAGGTGCTGTCGTCCAACCCGATCCTCGAGTCGTTCGGC
AACGCGCGTACGATCCGCAACGACAACTCGAGTCGTTTCGGCAAGTTTATCAAGATGGAGTTCTCCCCGCGCGGCGAGCTGGTCGGCGCGTCCATCCAGA
CGTACCTGCTGGAGAAGGTGCGTCTCGGCTACCAGGCCGAGTCGGAGCGCAACTACCACGTCTTCTACGAGATGATCGCTGGCGCGTCCGAGGTGGAGAA
GAAGCGCTGGCACCTCGCGTCCCCGAAGAAGTTCCACTACCTGAACCAGAGCACGTGCGTGAAGCGCAAGGACGGCGTGAACGACGCCGAGCAGTTCCGT
GTGCTGAAGCGCGCGATGGCGACCATGGGGTTCGACGCCGAGAGCATGGAGTCGATCTTCGCGACGGTCGCGGCGCTGCTGCACCTGGGCAACCTCGAGT
TCGACGAGGTGCACCACGCGTCAGGAACGGAGGGCTCGACGATCGCCAAGGCGTGCGCCGACTCGATGCAGGTGGTGCTCGACTTCCTCGAGTGCGACCA
GCCTGCGCTCGAGCAGGCCGTGTGCCACCGCAAGATCCAGGCTCGCAACGAGCACTACACGATCGGTTTGCTTCCCGACGCGGCCGAGAACACGCGTGAC
GCGTTCGCGCGCTTCGTGTACGGCAAGCTGTTCGACTGGCTGGTTGCGCGCATCAACGAGATGGTCGCGTACGGCGACGACGACGACGACACTGCCTTCA
TCGGTCTGCTGGACATCTTCGGCTTTGAGGACCTCGAGCACAACTCGTTCGAGCAGCTGTGCATCAACTACGCGAACGAGACGCTGCAGCAGCACTTCAA
CCTGACGGTGCTGCGTCTCGAGCAGGAAACGTACGAGCGCGAGCAGATCAAGTGGAGCTTCATCAACTTCCCGGACAACGGTCCGTGCATCGAGCTGATC
GAGTCGAAGCCGTTCGGCGTGCTCCCGGCGCTGGACGAGGAGTGCATCGTGCCGCAGGGCAACGACCAGAACTTTTCGCGCAAGCTGTACCGCCAGCACG
AGCTGAACCCGCACTTCAGCGCGAGCAAGACGGAGCAGGCGAACCACCTGTTCGTGATCCACCACTACGCTGGCCAGGTGGCGTACGACTCGTTCGGGTT
CTGCGAGAAGAACAAGGACATTTTGTACCCGGAGATCACGGGTATCCTCGAGCGCTCGTCCAAGTCGTTCGTGCGCGGACTGCTGACTGCGGGTGCTGAC
CGCCCGGTCGCGCCTCGCAAGGGCCGTGCCGCCAGCGCCGCTAGCCGTGTCAGTCTCGGCTCGCAGTTCCGCTCGCAGCTGAAGAGCCTCATCCAGACGA
TCAACGTGACGTCGTGCCACTACGTGCGTTGTCTGAAGCCGAACGACAAGGCCAAGCCGGACATCCTCGTTCCGAAGCGCATCTGCGACCAGTTGAAGGC
TGGCGGTGTGCTCGAGGCCGTGCGTGTCAACCGCGCGGGTTACCCTGTGCGACTGCACCATCAGCAGTTCATCAAGCGGTACCGTCCTCTCGCGAACGGC
GCGTA