Description :
From Genome Similarity Track
Location :
Scaffold_292:585215- 586449
Transcript NameFunction/comments
Aphin_H310_08729Hypothetical protein

Sequence
1234 bases(100 bases per row)
AATCCATATAACTAATGCAAGTGTAGTGTCGCGTGCACCTGAATGGGACTAATAAAAAGAATCCGGATAACATCCGCAAAATCCGGATAAAATATCGGCG
GGAAAACTTGGCGGCTTGTCCAAATCATGCGCGCTGGCACCAAGAAGAAGAACCTGACGAACACTCAGAGGCAACACCTACTTCAGCACCTCTTGAAGGT
CTGCCTTCCGGATGGCAAGCTACCTCGAGGCACAGTTAAGAGCATGGCGATTTTGTTTGATTGTGACCCAAGGACTGTTCATCGTATTTGGGCACGCGCC
TCTCTTGATTGCCCCGGCGTGCAGGCCATATGTGCTGATGTATCTTCTCGAAAGTAGACAAGAAGTGGACGAAAGATTAAATACATTAACCTTGCAGATC
AGCTACGCAAAGTCTCTAAAGCTCGTCGAACCACCTTTAAGTCCACCGCAGCAGCAATGGGATGCCGCCGTCGACACTTCATGACTACTTCAAACGAGGG
GTCTTCTCGAAATACTCAAGCAGCATCAAACCTTTATTGACTCCGGCAAACCAAGCTGCTCGACTAAAATGGGCACTTGACCATGTCCGCCACGAGAACG
GTGAGCTTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN