Description :
From Genome Similarity Track
Location :
scaffold_1090:5851- 7237
Sequence
1386 bases(100 bases per row)
ACGTCCGTTAATACACATTATTCTAGTTTTCGTTGCGTTGGCACTCTTTCTGATCTTACCTAAAAGACACTCGTCTTCTTGTTGACTCTCATCGTGCACA
AGTTACCTGACCAAGATTATTCCAGGATTATGTCCAGGATTAATCATGGATTATCCCTGACCGCACAATTATATCTTTCGAGTCCGTCTCGTCCTCGATC
GAACCTATCGAATATTACCCAAATGATCTTGATGCTAAATACGAGTTAGTGTATACAGGATTAATCCTGTAAAAAATCCTGGATATTTCCATAATTATAA
TCCTGAACTCCAACACCCGCCTTACATAAATGGACACCTTTACTACATGTCATGGATACTGAATGCTTGCATCGCGTATGTTGCCTGATCATGTAGCATC
GGGCTCATGCGTACAGTTTTGAAAAAAAAAATGAACAGCCACAACTCACGCTACTAAACTGGACTTAGGAATGAGTTTACGATAATTTGAACGGATCACA
GTGCAATACGGAATGTTATGATGCTACGTCACCGTTGTTGCAGCTCCGGTGTCAACATGAAGGAAATGATGCTACGATAAGGACTGAAGTTGCTAACCGT
TTGCTTTAAGGCAGCCCACGCGGGCAAATTCACAAAGTAAAAACCTGAGTGCCGATTAAGCCGGCAGTCGAGTAAACCTGCACCCCGGTGCAAGTTTCGA
ATAAACCTGCACACTGGTTCAAGTTAAGCCGACAGTAGAATAATCTGCCAGTTTTATCACACCGCAGTTGAAAACTGGACCTGCGGTGTGATAAAATGTA
CCTTTATGTTTAGGTCACCTAACCATCGATTGTCTGTTTCCTAGACTCTTGTCCACAAGTTGACAATTCGTGTCTGTTTTTCATATTCCCTCGAAATCTC
TTGGATTTCTAAAGAAATAAAAAACGGAACTACAGTACCACAAAAATCGATTTCTTTCCAAGTGATGTGATTGGCTTGTACTTTCAACGAAGCTTACAAA
CTTAGTGGCACATGGAAGACGAGGAAATAGCTCCTGCCAATACACGCGTCCAGCGGCTGTCGGCTGCCGCCTTCAAAGCCTTAAAAGATAAGGGCGTTCC
TGAGCGAGAGCTGCAACTCTTGGAGAAAGATCTCCAGGGCGAGCAAGTCGATGACAAGGTGAAGAGACAGATCAGAAAGGATATTCTCGCCACCTATGAG
AAGTTTTATAACCGCCAACTCTCAAGAGCCGACATCTACGCAGCTACAGATGCCGCCACAGCCGAACTACGCGTCATCCAGAGCCAACCCCCAGTCCGCA
AGGCCAGTCCGAAGACCCACAAATTGGTACCTGCAGCTTTCGATATACCTTATGAAGGTGATGCGGACGTCAGCTTCCAGAAGTAC