Description :
From Genome Similarity Track
Location :
Scaffold_1:5850857- 5869876
Transcript NameFunction/comments
Physo_248380dynein heavy chain
Physo_553656GTPase, putative
Physo_553659glycoside hydrolase, putative
Physo_323607tyrosine aminotransferase, putative
Physo_468426JmjN/JmjC protein
Physo_553663predicted protein
Physo_295519Hypothetical protein

Sequence
19019 bases(100 bases per row)
ACTCAGCGCTGCCTTGATCAGCGCGTTGGAGAACTGCGAGTTGCATAGCTCATCGGCAAATCCTGACAAATGTCCACCAAGGAAAGTCTCGTAGATTGTG
ACCAAACTTGGTGCTTCGGGCATGCCCATAGCGAATGTACAGAAGTGGCGCTGAAGGCGTGGGTCGACGAGGAACGAGCCTGCCGTGGGATTCATACCAG
ATACCACTTGAGTATTCAGGATATTCTGAGGCTGGAGCTTCACGCGGTCGAACCAATGTCGGTACTCCATCACCTGTCGTAGCAGCGAGATAGCGCTTTG
TGTGTTGTAAGGGTCCACTTCTGGCAGATTCAGATCGTCCATGAAGTAGATGAGTCGGGCTTTGCCTGGTGGACCAAGGTTGATACCCGTCTTGCGCTCC
AGTTGGCCAAACATGGTCTGCTGCAAGATCGCACTCGTGGTGTAGAAGTTGAAGTTGATGGTGCAGTAGCGGAATGCAGCCGTCGCCTCGTCCTTGCTGA
GCTTTTTCAGCATGCCCATGATATTCTGCGTCTTACCGGTACCTGCAGGTCCGCATACCATCACTGGAACACTCTTGGAGATGAGGTTCTCCAGCCAGAA
TGCAATCGATGCCGTCTCAGTCGTAGGCACAGTGATCTGGTTGATCGGGCTCGGAGAGACATACGTCTCGGTGTAGAAGTACGGGCTCTTAGACCAAGAA
TTGAACTTGGACGTCTCTGGATCTAGCCAGAAATCAAACACAGTGTTGCTCGCCGACGCCACCAGCTTCACATCCTTCCACTGGTTCTTCCACCAGTTGC
TAAACTCTGCCGAGTAGTCTGTGCCATCGTCACTCATTGTGAGGATGGAGCCGAAGGACCATACGCAGCAGAAAACGAATGTATTCTGCATCACCGTGTA
GTCTTCCAGCACTTGAGGGGTCAGCAAGCAGTCGATCATGTTGAGCAAGTTCGTCACAAGTGTCGTCTCCTCCACTGGTACAACAGGAACGAGCTTCTTG
CGGAAGAACCTGAGTGTCGTCTCGACGTACTGGTCGAACAGACCCTGAAATTTCGCACGCGTGTCTGGAGTGAACATCATGTTCCTCAAGCGATGGTCAA
CAGGCTGCTGGCAGTGTCGATCCAGCCAACTATCAATCAAACAGCGCCACTGGTAGCCTTCCGACGTCGAAATGTACAGGATACCTGCTCGCGAGACGGT
TGCCGGAGTAGCGTAGACGAGATCGCGGATCTCAAAGATCATGCGCATGTGAACCTTCAGCGGGATACGCTCGTTCGAAGCCAGCGTTAGCATTCTGTTA
TCGTCCATGACGGAGTTCATTGACTCGATCCAGTTCGCATCAAGATCGCCATCCAAGATAATCCATTTGGGGTTGTTATCCTCGTCGCCATTGTCGCGGC
GCCGGGAGCCCAAGTCACGCATGATGCGTGAAAGCAAGCCGTCCTTCCATTCACGTGTCTTCAGCACAATGTACCCGTACAGTTCGTTCGTGCTCACAGA
CTTGGGGTTCAAGTCTTGCACTTCCATAGGCGTTCCCATGATTTCACGCGCCTTCTTTAATGTCTTCCAAGTCTCTGTTTTCCCCGACGCAGGTGGTCCC
ATCACGAAGACGCAGTGACGAATAGCCAATAGCTCGGACAACTGCACAACCTTGAGCATGAACTCCGGACGAGGCGTGTTGCCGATGGCTTCCGAAGCTC
CTTGCACCATGGATTCGAGTTCCATGTCACGCTTGCGCGGAGGATCGTTGCGTACGTCTACATTCGGGCTGTCGCGCGGGAATAAATCTCCCAGTAGACC
AAAGAAAACCACCATGTCTTCTGCCACGATTTTTGGGATATTGAAGTCTCGCAATGCGCGCATGAGCAAGTCGGTTTCGGGGATGTCAGGCTCTGCACGC
TTGAATGCACCAGCGACGCACAGCACACTCTTCACAGCTCGAAGACCCCAATCGTAGTGAAGCTGCTTAGACAAAAGCTGTCCGAGCAATGAGTACAAGC
CATAGAACTTCGACGCCAAGATCTTGGCCTGCGTAAATCCTTCTGCCATCAGCATGTTCTCACAAATCAACACAAGATCGGGCACCATGACAGTCATGGG
GCGGAACAGCGCCTTCAAGCCTTCAGGCAACTCGGAGCGTCCCAGGTAACCAGGGTTCATTGTGATGAACGCACCCACCGTCGGGTCCAGCATGACCTCG
TCGTTTTCGAGGATAAACCTCTCGTCGTCAGCTTTGCATGCATCGCACACAGCCTTAAACTGAACAGAACACACAGACAGCACCTCTGGCACAAGGCGGT
TGAACTCGTCGAAGCAGCCCCATGAGCCAGAGGAGGCAAGTCCCTTGAAAATGTTGCCTAGACTCTTGAAGTCCATCTCAGGCGAACAGTTGAACACGTA
GCAAACTTTGCCCAGTGCGTTTGCCAGATCCTTGGTTGTCTCCGTCTTTCCTGTTCCTGCTGGACCGGCAGGAGCGCATCCCATTTGAAGGTTCAGAGCC
TGCGTCGCCGTCACGTAAATTCGATCGGTCAATGGGGTAATCACAAGTCTGGGGCCATTTCCAAGATATTCGTAGTCGTACGGAATACCCGCGTCACAAA
TGAGAATCTGAGCGCGCGCGTTGTTTGCCCCACGGAAGGTACTGTCACGCTTGAGGAAACTTCCTGCTGCAGGTGAGAAGTAGTGCTTTAGTTGAGACTG
CCACTGGAAATGAGTAGCCTCCTCCACCCCAGCACGAATCATGTTGGCCACGATATCTCGACCGTGGGCGTCCATCGTGATGAGCACCATCACACGCTGA
CGCTCGGCATAGGAAATGTTGCTTTGCGTCAGCTTGATCAAGTCTTCTAGTTGCTTTTCCTGCATCTTGTTGTAGTTCTTCAGAGCATCCTTATCGCCTC
CCTGGATGCCACGGAATGCACGCTCGACTTCCTGAACATAGTGTACTCCAGCTGCGAGTAGGATGATCTGCGCTGCGTCCATGGGTTTGTTCGTGTCGTC
TTTAAAGTTGATCCAGTCCACACGTGGCATTTCGGTGTATGCTACGAGAGATCGCTCAATGTGCTTGAACAGCGTCAGCCTCATTGCGCGCATGATAGTC
TCCAGATAAATTTCAGCCTCTCCCTCCAGCACAGGAGGCTCAAAGAAGTCAACGACTTCATGACCTACTCCAGCCACAAAAGACGTAGCAACGGGCCGCT
CTCCTGGTCCACGATCCACCAAGGTGAGCGTCTTGGTTGCCAGGTAAATTTTGGAGCAGTGCGGCATGATCCGATCCGGGTGAGACCCATTCGACAGGAT
ATCCAGCAAGTCGGCCTCGGACATGAAGTAGAAACGTGGGAACTGGCGGCGACGCCCGTCGAGAAATTCTTTCAGGCGGTGCTTACACAACTCCAGCTTT
TCCACGATCACCTCAAGACGCTTGATAAGACCCGGCTCCGTACATGCTTGCTGAACGTTCAGAGTCTTCCATGCCGTCTTGAGGATTTGGCGAACCTCGC
GGTCAATGTCTTCGAAGTCTGACGTTAGCTCGGGCAATTGCTTCTTCACCTCTTCGGACTGAATGAAAAGCGGCTCCAAGTAACTCCAAGATCTCTGAAT
GTCGCCAAGCAAGAGCACGACTTCGTTGATGGACGAAAGGCCGATCTGGAGCTTCGCAACACGAGGCTCAAACTCGGACTGGTACGGCGATGCACTCATA
CCTTGTACGTCAATCTGATGAGTCTCGAGAAGCTCGAAGTTTTCTTCCGAAACCTTGAGAAGAGGCACAACATCTTCTTCGGCAGCGCCTGGGTTGTAAG
GGGACATTTCCCAGTTCACCTCAGCCCACAGGGCCTCGAGCTCGATCAAACGAAGCTCCAGCTCTTGTTCCTTTTCGGCTTCGTAGCAGATTTCGTTAAT
GTCCGAGCTGAAGTTGAAGAGATTTTTGCTGAGAATTAGAGAAAGCCGCTGCTCTGGATCTTCATCCGGAGTGGAGAACTCTCCTGTGTGGGCCATGATT
CGCTTCCAGTGCCTAGGGCGCATGTAGCTCGATGACACACACCGAATCAGTGGGTGCGTCTTGTCAAATGCTTGGCATTCCTTCAGGATGGAGGTGTACG
CATCGCTCCATTGAATCCCCTTGGGGATCTTCTTCAGCTCTTTCAACGCGGACTGCACTTCAATTTGCAAAGCATTCACATCCACTTCCTTGAACAAAAT
GTCCTGAGTTGCTGTGAAAAATGATTTGGCACGCTTGATGATGGCCCACACAGTCTTCATCGCGTCTGCATCCGCCCTCATCAGTCCCATCATACGAAGC
GATTCATTCATCAGCTGCGGGAACCCAAAGATGGAGCACAGCTTCGTATTTTCCTCGCACTTCTTCATCTCCATATTCCAGTCGACAAGGTAACTCTCAA
TCTTCTCAAGACCCTTGTCAGGCTCCAACTTCGACGACCAGAAGTCGAGGGTTTTGAGCGTCTCGACTTTCTGAGCAATCATCTTTTCGTACGCGATGAT
CTTCTCCTCGGTCTTCTCGCTGAATATCCGCGTCGGCTCCTGGGTCCTCTTCTCCGTCACTGGGATTTGCTTCTCAACGTCGACGAAAAGCTTCTCCATG
TTCTCGATTTCGACCAGTTCTTTATCGACGTGGCCACCACTCTTCTTGATGTTGAAAAACAATTGCCGAACTTGGTCTAGGATCAAATGGTTTGTCGCCT
TGTCCGTCTCCAGCTTGCGAATAATTTCTTTCACCTTCCGCAGAGTATCAAGTCCTTCGGTATCGTTGTTCGGAATGTCCTTCCGCAGGTCAACAAGAAG
GCGTCGGAACTCTCCGTTTCGTTTATTCATTGTCGCCATCACTCGCCGAATCAGCTCAGGCGAATCGAAGTCCTTCTGGGTCGCAAGCGGGGGTAGACAC
TTCGTCTTGTTCTCGTCATTCGGAGGCTGGAAAACCGCCGTAAAGGGCGACCCACGGATAGGCCCTGCGATGCCATTGAACGTGCCCGTGAAGTCCACTG
ATATCTCGTACTTGCCCGCTCGAGAGGGGGTGAATGTCACCACGTAAGTGCCATCATTCTTGTCAAGGATGGATCCAACCTGCTCCACTTCAGCCTGCGG
ATCATCACAATACTTCAGCAAAAAAGTGAACTCGTCACCGCCGCAGTCGCGAGGATTGTCGTCTTTGTCTCGAGACTGGATGATGAACATTGTCGGCAGC
TCAGCTAGACAGTTGTCACTGAGAGCTGCGATCAAACAGGGTCCGAACGCTAGAGACTTTGGTGCTGCAGTAACCGAGTGGAATCGGAAGGATGTCGCGA
CGTTCGTATACATTCCTCCGGATAGTGAGACGCGAACCTCGGAAGTCATTGCACCGAATTTCTCGAAGCTCGGAGCTGTAGCTTGAAGGACGCTAGGACT
CAGAACAGCTCCTTGGACGTCAACAGAGCCCTTCGCAACTGCAAAACGCAGCGTTGCGTTTGTGCCGGTGAAGTTGAATCCAGTAATTTTCACTTTTGCG
TTACCCGTGATCGGTCCTTGCTTCGGTTCGATCGACGAAATGGAGTACGGCGGTCCGACGATTTCGCTTGCGTTTAGCACGTGCAGGTCATTGTACCAGC
GATTCGCCCACCCCCCAAAGAAGATCAAGTGGTTGGTATTCGAGTCAAACACCATTGCAGTATCCGCGCGCGCCTTCGGAAGCTCTCCCTTTACGGGCGG
ATTTAGCCACACCATGGCACCTGTATCTAGCACAGTTGTGCTGTTTAGGTATGCTCCTTGCGCTGTCCCTGACTCTGCAAGATCCCCGCTATTACCACCG
AAGAGGAAAACTTTCCAGTGGGGCACAGCCGCCACACTAACGCACGTGTGGTTCCAGATAGGCGCGTGCAGTGGGGTGCTCAACAAGCTCCACGTCTTGG
TAGGTAAGTCGAAAACGAAGATGTCTTGAAACTGCTTGAAGCTGTTCCAGCCTCCAATGATCAGCAACTGTTCCTTAACCAGGCACGTCTGGTGACCTGA
GCGTGGCTCAGGCTTCTCGCCGTCGGTTTGAATTTCTTGCCACTTAAAGGAGTGCAAGTCCAAAGCATGAAGGTCGTTGAAGTCGGTACGTCCGAAGCCG
TTGCCACCGTAGCCACCGAACACGTACATTTTCTCCTCGACAAGCGTAGCGCTATGTGCACCGCGGCACTGCGGTAGACCCTCCCAGAACCCCTGAGCAT
ACTTCTGCTCCCACACCTTCAATTCGGTGTTGAAGATCCAGAGGTCGTTCATTCGCTTCTCAGCCGCGAAACCTCCAAAGATGATGATGTTCTTCTCGAA
CAGGATAGCTGAGTGTCTCCAACGAGGCGCTGGGACGTCGTCTTCACTCTGAGAGCTTGCTATCTTGGACCAAGTGTAGCCTGCCATAGTTTTGACGTCG
TTAAGTAGAGTTTCTAGTTGGGATGGTGGTGCGAAGCTTACCATTTGAGACGTCCAGCCTGTAAAGTTCGTTGGTCGGTCCTGGGGGCGACTTGTGGTCA
CACCCGCCGAACATGTAGATTGCGGTCTCTGACTCGGAGCTCCTCAGAGTGAAAGAGTGACCAGATCGCTTGATTGGGATCTCGCCATTCTGCTTCGGCG
CAAGCCACACCAGCTCTGGCTCGCATCCATACCCGATCGGCTGCCCAAATGCAAACACATATTGGATAAACCTCTTCAACTTCGGAATGACGCATCAAGT
GGGGGTATCTGTGAACGCACCATTCTGGCTTTACCCTCAGTGGGGTATGCCTATCGTAGAGTTTGCTGATAGAAGAGGAGTTCCTTGCCCACCGACAACC
TTTTGTACCCGACCGCTTCTCCGTCCGCGGCTGCTTTGCAGATATACCGACGCAAGTGGCAACAAACACGTCGCGACCGGGCGGCATTCAAAAAGTCGCG
ACCGGTCAAGTAGATATCGTCCGTTTCGATAGCTCTTTGAAAAACCTGCAAGCTGCAGATCCAAACACAAGCCCCACCACTGCGCTTCGTGAAGTTCCAT
TTTGTGCTCAAAGCGCATGCTTTTATTTCAGTGCGGGATGCTCTGCAGCAATCCGCTCTTCATTCTGCATACTCTAGACGCGAAGACATCACCTGGAACA
AGGCCTCACAATACCCAGGGCATTGCTGGAGCAGGAGACCCGCACTTGTTCGTCTCACTCAACACCAGTGGCAGCACGTTACCCACTTAGTTGTTGAACT
TGAAGAAAATAATGTCGCCGTCCTGGACCTCGTACTTCTTGCCCTGCTGCTTGAGCTTGCCGGCCTTCTTGACGGCCTCCTCCGAGCCCACTATAACATC
GTAAAAACAACAACGTTAGAATCCTTGAGCAATGCACAACAGCAACAGCCCCTAATGACACATCGCAGGCATAAATAGGTAAACTTACGCTCTTTCAGGT
CAGCGAACGCCTGGACTTCGGCCATGATGAAGCCCTTCTCGAAGTCCGTGTGGATGACACCGGCAGCCTGGGGTGCCAGCCGGCCCTTGCGGATCGTCCA
GCCACGCACCTCGTCCTTGCCGGCCGTGAAGAAGTGGATCAGGCCAAGAGCCGAGTAACCCATCTTGAGCACACGGTTGAGGATGGACTTGTGCGTCGGG
TTCTCCTTGTAGTACGTCTGCAGCTGACCCGCGGCCTCGAGGTCCAGCATCTCGAGCTCGAACTCGCAGCTGAGCGGGATGACGGGCTCGTTGCCGCCGC
GCTCCTTGATGAACTCGGCGATCTTGGGCAGGTACTTGTTGCCCTTGCGCAGGTAGTCGCGCTTGCTCACGTTGATGAGGTAAACCACGGGCTTGGCCGT
CAGCAGCTGCATCTGGTTGAGGATCTCAACCTCCTGGGCCGACCACGTGCCGAAGGACACGTCCTTGCCCGACTCGAGCCACTCCTGGATCTTGCACAGA
GCCTCATACTCGAGCTTCTTCTCCTTGCCGCCGACGCCGCGCTCCGCGAGCTTCTTGACGCTGGCGCACTCCTTGGTGATGCGCTCAATGTCCTTGAGAC
GCAGCTCCTCCTGGATGATCTTCATGTCACGCACGGGGTCCACGTTGCCCTCCACGTGGGTCACCTCGGTCGAGTCGAAGGCGCGCACCATGTGGTAGAT
GGCGTCCACGGCCTGGATGTGCGACAGGAAGGCATTGCCCAGACCGGCGCCCTCGGCGGCACCGCGCACGAGGCCGGCGATGTCCGTGATGGAGATGACG
GGCGGCACGACGCTGGCGGGCTGGTACTTGTCCACGAGCCAGTTGAAGCGCTGGTCGGGCAGCGGCACCACGGCGTCATTGGGGTCGATGGTGCAGAAGG
GGAAGTTCTCGGCGGGGATGTGGAGCTTCGACAGGCAGTTGAAGAACGTACTCTTGCCCACGTTGGGGACGCCGACAATGCCGATCTTGACGTTGTTACC
GGGGCGGCCCAGGTACGTGCGCGTGGGCTGCAGGGAGGAGGGAAAGAACAGACAGATAGTAGGGGTTAGATACAGAGAGGGCAAGGCGCATGCAGCTAGA
GGCACCGACCTCTTCGGCCTTCTTTCCCTTCGGCGGCATGGTAACGGGGTGGTGCGTGGCTCTCGCTGCTGGTAGACGTGAAATGAAATGAAGCAATGGC
GCTCGTGCTCTGGTGCGGATTTGAGGGTTAACCTCTTTTTTCATTGGCAGTTAATCGCATAGCCCTTGACCTCGCAGTGAAGCACATGGCTTCATGGATC
GATAGGGAAGTCGCTCTGATTCGTGTCATATCATGGAAGTGTTATTCAATGGATGCAAGCGCAGTTCTCGTAGTCGCTGAGCTCACTACAATATAGCGGA
TCTAGCGCATCTACAGAGCAGCTTGAGTGTTGCCGCCAGCCTTCACCTGCTGAGCCAACCTGTCCGTTTCTGCCAAACATACCACAAGCACCAGCAAGAG
TCAGTGAGATGAGTGTTCGAACGCAGAGAAGCAATACGCCGGCCAAGACACGTACCAGCTTTCTTCTTTGCCGCCGCAACACCGAGGGCGATAAAGACTA
CCGCCATTACCGCCAGGAACGCGCCGACGCCCACGAAAATCGTCCCGGGTGCCGACTCCGAACTGCTCAGCGTCGCGCACGAGCTAATATCCTTAACGCT
GCAGTCGGCACCCGTGTAACAAGCCAAGCAGCTGCAGGACTTGGTACCGTTCGACTCCTTGCACTGGCCGTTGCCACCGCAGTCGGACGTGCTCTCGCAA
GTCCCGCCGCCACTTGTAACCTCGTAGGTGCCGCAAATGTCCTCCTGCGTCGTACCGACGCTGCTGCTCAACGTGACATCACATGTATCACCGTCGTCCG
TGCAGACAACGCCTTCACGGCTGGAGCACGTCCACGAATCTGAGCTAGAGATTTTCAGGTAACTGGCCGAGCAACTGCTCACGATCCAGCCGTTCTGCGT
TGCATGCTTGTTGGTTGACTGCGTCTTGGTCTCCAAGGTAGGTTTCCATGAGCACTTGGTGCTGTCAGTCCACTCGGCATCGTCCGTGTACCCTGAGTAC
TTTGCAAACATAGCCTTGAGGTTCGTGTAATCCGTCGTGGCCTTCGAACTGGGCGTGCTCAAGAAATCAGTGCTGCCACCTACAAGTGGAGTGCAGCTGT
TAGTTCATCAGTCCAACAAGGCGGTGCAGTTAGCGTTGCATAGGTGACATACCTTTGAACATCGGGAAAAGCGAGTCCGTCGCAAGTTTGGCTTCACCAT
ACGAGTATGCGAGACCTCCTGACCAAACCGCGGTAAACTCCTCTGTCTTCGAAGGCTCTTGGTACATATAGGGAACCATTTTCCAGTCACGTGGAGTTGC
TGAAGACGTTTTGCAGCCGTACTCGCCAAAGGCCACGACGATGGGAATGCCCTGGGCCATGTTAATGTAACGCTGGTACGCCTCCGCGAACGTCGAGTCC
GGGCACCAACGGTATTCGTTAATCAGGTAGATATCGATACTCTCCGTCATCATTCCGTTGGTCATCTTGTCTCCGCAGAGAAGTCCCTGGACCTTCATCA
CGTGGTAGTCGTCGGCGTTGGAAATCTCATCGTTACTACTGTCGGCAGCGGCGTAGGCAAGCGGCAGAATACGAATCTTCTTGCCGTTGACCGTCATCCA
GTTCTTTAAGTCCGCCACGTAGGCCTTCACACAGGAGCCAGCGGTCAGGTCTGCCTGCATGATTTCGTTTGCCACGACAACGCCCAGTGTGTTGTCGTAT
TGCGCAAAGTTCTGGATGATCTTCTTGCCGTACTCCAGCAGCAGCGCTGGGTAGCAGGTCTCCGTCTGGTCCACCGTCTTGGCGCCGTCGCCGGACGACA
CCTTACCCGAGCAGCTGAGCTTCTTGGTGATGGTCGAGTAGCGATACTTGCCGTAGTAGGCGTCGTTATCGGGCGAGGCCGACACCAGCACGTACACGCC
GAGCGCCGCCATGTCAGTCATGAATTTCTTGTACGAGGACGTCGGGTTGATGTTGTACAGACGCAGCGTGTTGTACTTGAGCCCCGAGAGGTTTTCCTCG
ATGGCGGCCTTCGAGTACTTGTCGTAGTAGTCGTCGCTCACGGCGTACTCGTAGGTCAGCTGTATGGCACATACAAAATAAATATTAGAACCAAATATTA
TTCAATCAAACCGTGCTTTGCTGTTAGCGGCGGCTCCTTCCGATCCTTGTAGCGCCGTTCGAACGCACCCCTTTGATGAAGAAGCGCTCGCCCGTCTTGG
CGTTGTAGAGCTTGTTGCCGCGCACGATGATCACGCCGTCCACGGCCGCGGCCGCCATGTGCTGCAGCGCGGCGACGGCCAGCACGGCCAGCAGCAGCAG
CGAGCTCCGTCCAGTCATGGCGTCCCAGGCAGGCGAGTCGCGGTCGGTCGGCTCCGCTTTTCACTATGAGCCTCTCCCTTTTTTCCTCCCGCCGCGAACA
GAATAATTTTTCGAGCGGATTTTCTACGCGGGCAACAGCTGGTGCACCCATAACGATATGGAGGTATGTCGAGAGTGATATTGTATCAGCTATAAGAGTC
TGCCGACAGAATCTCTGCTCATTAATCATGAAAACAGATACTCTTCATCAATCAATAGACAGAGTTAACCGCGTTTTGGAACAGGCGTGCGATGTGTAGG
GAGACATTGATTCATGAGCTCTCATTGGCCATTAATGATCGGAAATGATTTTTTTAACGCAACATTTCACTTAGAGGAAAATCAAGTTTGGTCCGTCAAC
TGATCCACACCCACACTTGCTTCATTCAGTGTACTGGTGGCGTCGGCAGAAGTCAGCGAGGCGTGCGAAGGCGTCCACCAGTACCTCGTGCGGAGCCGAG
AGCACGATGCGGAAGTAGTTGTGCATTCCAAAGCACTGCAGGCGGGACGGAACACGCAGAGCAGGAGAGTCGATTAGTTTCAGAGGTTGTTCTGCCGAAG
TGCAACCAACAAGTTCAGAGGATCAAGTACCTGACCGGGCAGCACGAAGACAGCCTCCTCGTCCAGCAGTTTCTGCGTGAAGTCCAAGTCGTCCTTGATC
TCCGCCAGTATGTCGACGTGCAGCTTCACCTGCAATAGGCCAGGGCGAGATGTTAGTGCAAGATACTTTGTTTTTGGTGCGGTGTGCTGTTCGTACGTAC
CATCGCGTACATCGCACCCTGAGGCACCACCACTTCGAGACCCGGGATCTCACTGATAGCGTCGACGGTGAAGTTGGCGTTATCCTCCAGGGTTGCAAAG
TACCGTTTCTTAAAGTCCGTCAGCGACTGCGCCTCGGCGCTGCCGGGTACAGGTGTCAGCAAGTCTGGAATGGCGCTCTGGCAATCGACACTGGTGAGCT
CCGCGGTGAGCAAAGCCACGATGAACTACACATGCAAGCAAGTTACCTGGACGAGTGAGTTTGCTCCAAGGGTGCTTCTTGACAGCTTGAGATAGGCTGT
GCGCACGTCTTCCAAGATGTTGTTGCGGTCGTTCACGATGACCCAACCTACTCTCCAACCAGGGATCAGGAACTGCTTGGCCAACCCACCCACAGTCACC
ACGGAGACAGTCTTCGTCAGTGTCGCCATGGGGAAAAATACGTTGCAGCCGAATACCATGTCCCCGTAGATCTCATCCTGAGAGTGGCATACAGGTTAGA
CTCGTAATGTTACAAACACGTAAGTTATCATCTACTTACCGCGATGATAGGAATCTTGTTCAGCTCTGCTAGCTCGAGAATTTTTTCTAGGTGGGGCTAC
CGACATCAAGGGTGATGTTAGCGTTTGCAGCCTTCAGTAAAGTGAAGGACGTTCGAGTTTCCTTACCTTTGAGAACACACTACCACAGGGATTGGACGGA
TTGTTCACGAGAATTGCCTTGGTGTTGCCGTCTATCAACGATTGCATGTGCTCAAAATCGACCTCCACTTGTTCTCCGGCTGAATGCCAACCGTAAATGC
GTGCGTCAGTACAGTATGCAATAACACAAATGAAAAGACTATCGTGCGCGTATCACCCTCACCTTCAGATTGTAGAACCTGTACTCGATCCTGTTCGATT
GGCACAATGCCTCGTAGAAAGGAAACCCAGGTTTCGGAAGTAAAATGTTATCGCCAGGGTTGACCAGACCACGCACGGCAATATCAATTGCCCCGGAACA
CCCGCTGGTGATAATAACGTCATCGGGTGTCAATGGAGCTCGTGTGCTGCCATAGCGCTGAGCAATTGCAGTACGAGCTGCCTCAGTGAATATATCCGTT
GTGCTGCATCGAGCTATAGTAAAACAGACGAGGGTCACATAAGAAAGCAAGTTGTATAGTAATGAACAAGCATGGCGGATCATACCGAGTGTTGCGGACA
ACAGCATTAACACGGACATCGGGGCAATGTAAATTGCCGAACACCGTTGGGTCGCCTACAAGGCATTTTTCTAAGTTAGTTCATCAGCGAATCGACACCA
GACTGTATACGGCCACCAACCGAGTGACAGCCGGATCAGGGTCTTGGTCGACGTCGCGGGTTTCTTGATGTTGTCCACAATCTTGCGAATCGGGTTCGTG
CACAGTTTGGAGAAGTCTGAAGGCTGAACATTCCATTGCGGTTTAGCATGCTGCTTGGTTTCCACCATGCTGACACTGATTGAGTTGTGGGGTCAAACCA
GTCGATTCGGATTCCATGCAGAGGTAGTGGATCTGGGGAGATCATTACGCCCTTCTGGCACTGTCCTATGATCCTCACAATAATCCATGACACGAGTTGA
TTATTGCCTATCCGTGGTCAATGCTTGCGGCAAACGCAGGCATGATGCTTTGTATGGTATTGCAGTAGGGGCGATAGCAAGGCTCTCGGATTTTGCTGAT
GTCGAACCATGCTTGAAACTTAGCAGAAGAATGACCGATACATTTTGGCTGCGCAGTCTTGGCGGAACTTCATCTGTTTCGTCAGAAATTGTTCCTTGAT
GATCTCGCCGTCGTCACCGAGAGCGTCAAACAGCACTTCCAGCAGATCACACTCTAGGTTATCACCCTCCCAGCAATTGGTTAAGACTGCCACCAATTCC
ACGCTAGCATTTGCCAGAAGATCTTTCCAGTCCGCAGCGTGCCTTCTTGCCAAAATTCGCTGCGTCTTCGTGAAAATATCATCATCCAACGATAAAAACA
CTTTCTCGCGCGCAAATTGAGCTTCCTCCGCAATAATTGCTGCTGCTGCGCTGATTTCGTCCGCGGGAATGCTGGGATCGCCGGCTTGTGGCGACGATCG
CAGGGCATGTAGCTGCGAGTCGCACTCCTGCTTAACTAGTTCCTCCAACATGACCCGGGCGTAATACGGTACCATGCGTTTATCTGCTACAAGCTTTTCG
CGCTCACCATCCCACCAATAGTTGACAGCAATAGTGAACGCATCCGAGTCCACCTGGTGCCACCAGCCCTCTGGAATCACAATTGCGTCTACAGGAGATC
ATAAAAGGTTTAGACATTTCCAGCTTGTTAAACTGTCGACGAGTTATCGAGCTCTTTGGTAAGAAAAGAGTTCAACCAACTCACCTCCTGTTGTGACTTC
GAATTGATGGACCGTCGCCTCACGAAATCGTGGGTGAGCTTTGAGATCGGGTTCCACAATGTTCACTTGACTGTGATTCGCCGACTTTGTGTGCACCGGA
AAGGGGTACAACTTTGCAGCGTCCGATGGAGGAAAAAGCGTGACAGTTTTCTTGCCGTACAAGACGACCAAAATGTTCTGGTACGCGTCGTAGTGCAGTG
TAGTTCGACCCGGTTGAACGGTCATCCACAAGTTCACTTGTGAAATCGGTTTGTCTTCAATACACTGGGGTCTATAAAGTCGTACAAGAAAGTCGTGAGT
TTCAGAAGTAGCGGATAGGACCACACGTGCAAGCACCTTACAGACTTACAGACGGAAATCGTTCATGATGGCCGGCAGACTTGCCTTCGTGCAGGTGGCA
TCAGCTTTGAGCACTGCGATGGGGCATTGCGCCAGATAAAACTCTAGGTCGTCAACCTCTTGCAACCAATGTGACTCGTTCCTGAACGCTGCTTGGTAAT
AGTCAATGAAGTCGCCAAACTTGAGTTGGACGCTTTGTCTTGCCTTCTCGTTGCCATGGTAGCAGCCACTCGATCGCTCTTTGCAAGCAATATCAACCAC
TAACGCACACGCTGTGAGAACATTAAACACCCAAGTATACCAAACAGTGCTCTTACCAGTGTCTCGATGCGTCGCAAAGGAATCGAGTGAGTGGACGGAG
CCAGGCGTGAAGTTTGGCAGTTGCGCGGGGGCCACGCATTGAGCCGAGAGGCCTCGTAGGCAGACTGGGTCCCCCCTGCCCATGTGAATTGAGCTCATTA
TGCGATGTGTGTGTGGTTCACATAATGACGGCACAAACGGCAAGCGACTCCGGTACTAAAGTATCTCAATTTCTCATGGCTACTTGATACTACTGCGGTG
CTAACTTGAAGCGGTAGATTGCAGAGAGTCTAGCGGTGGGGCAGTTGCACCAGACATCGGCTCCGCCGCTGACTGGCTCACCACCGCCTTAGCACCAGGC
GATGACTTGGAGTGGCGCACGCAGAAGCCGTGACGCTGGGCCCACTTTTGGCAGCCTTCCTCCGCGCAGCGTGAGCCGCCACCGTGCGCTCGACAGAACC
CTTTTGAAATAGCACCCTTCGTACAGTCTGGGTGCTGGCACCGAACACCGCCACCGTGAGTTTTGCAGCAACCACGAGACTGCACTGCGCGATGGCAGCC
TTCGACGCTGCAGAACTTGACTCCTCCGTGTGCGCTGCACTTGTGGCCAAACTGAGCCACACGTTCGCAGCCAGCCTCGGCACACAGGCGCCTCCCTCCG
TGGCCCGAGCACGCGTTGTTGAAACGCGCAAACTTAGTGCAACCTTCCACTTCACAACGGCGGCGGCGGTACCGCTTGGGGGCAGGAGCAGCAGCAGGAC
CGGCAGGAGTAGCCACTGCTGCATCCCCAGTCTTCGCAGTTTCAGCAACAGGTTCCATCGGCTCGTCCTTCGCCTCCGAGGTCATTGCATCTTTTTCCTT
GTCTTCAGCCGCCTTGCTCGAGCCATTGGATGTTACATCAGTTGCAGGAGTGCTCTTCGCCTCTGAGGATGCATCAGCACCAGTGTCAGCACCAGCGTCG
GTGTCAGCGCCAGCGTCAGCTGAAGTGTCGGTTGCAGTTCCTGGCGCCTTGTCGTCGCCTTCGGCCGGTTTCTTCTGCTTATCCTTGGCTATCACGGCCG
CTTGAAGCAACGTGTCGATCCACTCGCGTACGGGGTGGCCCTCGCTGTCCGTGGCGGGCTGTAGGGCCGTCGCATCCTGCTTGGCGGGGTGGCTCTCGGC
CACTTCGCTCATTGCGCCGCCAGTCGTTGATATTTTTGAGGACGATCTGCTACCAAGTCGCATGTTTCGTATGATGTTGAGCAGGTGGTCGACACCTTAC
CTTTTGTATGATCTGGCCCTTGCACACATGCTTCACACAAGATATGACTCGTAACAGGTCGTACCATGTCGCAGGAAGGGGAAAACTGCAAGTTGATGTT
GCAGGCGACGCTCCTAGCTGGTGCATTCCGCCGCGAGACCGAGCTCGACGATACTGTGGGCCTGTGGACGTGCGTTATATGTTCAACGAGCAATGGAGGT
CTCTCGAACGAGATGTCGGAGCGTTGTAGGACGTGTCAGCGCCCGCGTAGCCTGCAGTGGCTGCGTTTGGAGGACCCAGGAGTTCAGGTCCTCGATGTTG
TAGTGATGTCCGTTTGCCTCATCGATGTCTAACGTGTTATAATACTAGATCTTGTTAGGATCCAGAGTTATGCACACCAGCCCAGGTGGATCCAAGACCG
TGTCGGTCGTGGTGGCCGTCAACTATACACAAAAAGTCATCACGCTGCTGAGGTTGAAGGCCAAGCGCAACGAGGGCAGTGGACACGACGACATTAGCTT
TCACGAAGTTACGCTCAACGCGTCGCAGCTACAGCAACAACTTGAGCTACTGGATGCTGAGGAAGAGGGTGACTGTCTGCTCGATGACTACGGCATTTGC
GGAGAGTGTCGTGGCGTCTTCCGCGTCGCCCAGGGTGATAAACAGTTCCAGTATGCGAACGAGGACAAGATCGCTGTACTTCAGAAGGAGTTGCAACTGC
TCAGCGAGCTGAAGCAGAGGCTAGCGAGGGAAAAGGCATATGAACGAGCCCTGGAGTGTGCAGAAGACATCAAGACGAAGGCAAAGCAGCTTCTTGTCGC
AAAGCGTGAGCTTGAGTTCCTCACTCCAGTGTTCTGTCCATTCTGCGGGTGGTCGTCCTAGATACACGAAAGGAAAAGGAGACCGGGCGAAAGGAGAGGG
GTGACGTTGTATTGATAGTCCCCTTTAAATACTCAACGAAAACGTCTTGGTGCTTCCGTCGGTGTCGATAGTAGGGGCAGCGTAGCTATCCGGTATTCCA
CGAAGCCATCTTACTTGTTGTCATGTGGTGAACAATTTTCGCGGACACGATTGTTGCTACCTTGCTTGAATGAAAATTCGGTTGCTCGTTACATCACCGA
GCAACCGAACCACGACTCCTCCGAGCCGTTCGCTGTCACGCCTTCACCCGCATTGTCCAAATGCTTCATAGCTGATGCGATGTGCGTGTCGAAGTATGGG
TGCCACACGTGGTCATACATGAATCGAGCCGTGAACGATAGATCGTCCTTATACGCCTTCGCGACTTTGGTTCCTCCCCAAACACGACTCCGCTCTACGA
TCCAAGGCACCATGACTCGCTTGGGCTTCGTCGCGCGAAAGACTCGCGGCATCACATATCTCTGGAACGCAGTCTCCGAAAACGCGAGCTCAATGGCTGG
CTTAAAAGCTTCCTCCTCCAGCCCCAGGACGTTAAAGAGCAAATGGTTGAGACGGCGAATGTCGTCTTGCAGCATGCCCAAGCGAGTTTGCCAAGAGTCC
GCAGACGACGCCGCAGAAAACACCAAATCGTCTTCCTGCGCGATAATCACATCCACAAGCGCGAAAATGGCCTGGTACAAGGCCACGATATCGCGCTTCT
CCACGAACTTGATAACCACAAGCGGTAGAATGACCTTCATTTTCACGTCACGCTGGTTCCGAACAAATTCGATGAAGTGCAGCTTGAACCAGCTGAAAAA
CTCCGACACGTTCCAGTTCATCGGCGACGTCAAGTTGCGGCTGCGCTCCAAGAACTGGTCGATAACGTACAGTGCATGACGAACAGGCTCGTGCAGTCCC
AGTAAGAACTGCGAGTTCCAGCTCATGTCCACTTCGTTGTTCCGTGTCAGCACGGTCGAAAACACGACGTTCTCCTTCTTGTGCGCGGGCGCTGACACCG
GCGCGCTCATCACATTCGAGAAATCGTCCGCCGCAAACTCTTTCCGGAGCGTGTTGGCATCCATCCGCAGGGGGCCAAGACTCAACACGGACGAGGTAAC
CACTGACGAACTCTCCTCGCTGCTGTGCTCGGAAATGGGCGTGGACAAGTTGCTGGCGCTTTGTTGCGTCTTGCTCAACATGGCGGTCTTCGCGGCGATG
GCGTTCTGCTGCGACTCCAAGGACGCCCAGATGTTGAAGAACTCGGCGTCGCTCGGCCCGTCGTAGCCGCTCTTGTAGTCGATGGTTGTCAGAACGTGCG
CTACCTGGCTGATGTCCACGAGCTGTTTCGACTTCTTGGCGACAGGATCATCGCGCGCAGTCGCTGGAGGCGACCATATATTCGAGTAGAAGACGGTCTC
GTCGCTCGGGAGGCGGCGTGCCTTCTTGAGGCTTTCGTTCTTGGCCACCATGGCCAGTCGGCTTTTCACGAGCGGTTTGCGTTTGACGTCGGGCGTCACG
GGCTTGCTACGGGGCTTCACGGGGCCGTCTCGGTGTAGCACCGACTTACGCAGCTGGTACTCTCTGCCAAGCAAGTCGCTCTGCACTTGAACTGGCATGG
CCTCCTCCGCGTTCTCCGTGTACACCCGCTTGTGTCTCTCCCTTTTCTCCGCTTGATAGGGGGCAGCTTAAATCCAACAGATGCCCCTCAGCTAGCAAGA
GCTTCCTTGCAGTGAAGCTATCCGAGGAATGCCAAAATCTTTCGAGGCAGGTGGCGAGTGTTGACAGATGGGGGCCGACTACCTAGCAAGCGAGCGCCCA
CCAACAAGTATCACAGTGAGAACGCGCATTGCACACGGCGCCGCCGCGGTAGTCAAAAGGCGAAACATGTGCAGTCACCAACCTGTCTCCACAATCGTTA
CTGCGGTTGCGCTTGACACGTGAATTCAGGACTGAGGAACGCTTGGTTGGGGCGGCAGAGAGACGAACGCGGGGCTCGGGGTAAATGCCCGAGTTTCACA
CAACACACAAGTGAGCGCGGAAGGAGACTTGGGGCTGGTATCAACCCAGCGCAGCCAGCTGGGAGGTTGACACCATGTCTCGGTTTTCCAGAGAGCGGCC
CGCACAAAGCCTTCGCTGCTGCGGGGCGAGGGCGAGGCGCTCGCTGCCGGCCAACCCACAAGAAAACCGATCTCAGATATTCGGCGATGGACGCGGCTTG
CTTCGCGGCGGAATCGAGC