Description :
From Genome Similarity Track
Location :
contig_5:585081- 586802
Transcript NameFunction/comments
g1749.t1hypothetical protein

Sequence
1721 bases(100 bases per row)
GCAGCCGCCTACCACCGTCTTGATTCGTGTGCTGCAACCATCTCATACAGAGCAGGTTGCGATATCGCAGGGTGTCGAAGAGATTTGCGTACGTGTCGAA
CGATTGGGGAGTGGGGAAATCCGCTTGAAGTGTCCGCAGCGATGAAGCTCTTCCTCCATCTCTTTGATCAGCTGGAGGTCTTCGCCTTCGATCTGAGACA
GCATTAAACTGCTCGCGGATCCTTGTAGCAGTCCTTCAAATGTCCGTCGCCGCCGTTGTGCGTCCTTTTCCTTTTGGAGAATCGTCGGTGTGACCCCCGC
GCCAATTGTCGAGGTTGCTTGATTCCATGTAGTCGGTCTTGTTTGGCCTTATCGAGCTGCTGGGCCTCCCTTTGTGCGTCCACAAACGGGATTCCTACAA
GCTGGAACAAGTCGCTAACGAGGACAGTTTTGATGCGTTTGTCCATCGGCGACGAGCTGCTGAGAGACGGAAAAACATTGACCTCCAGTAGACGGGGCTT
CATGCTCTCACCTTCAAGCAGCACATCGAATCCGTACAGCTCGAATCCATTGCGTCGACAACTACTGCCGCTGGAGGCCGACGCTAATTTATCTTCGACT
GCAATCAGCGTTTTGACGATCAAGTCTTCGAGTTCTTCCTGGAAACTCTCAAGCTCACGAGTTTTGCCTTCGTCGCAAAGGTATTTGAAGAGCATCTGGA
GACTCCATTTGCTACTGGAGAACGCATGAGCTTCGATATCATCTTGATTTTTTTGAAAAGCTGCAGCATTTTTTGTTGTTGATGCTGTAGTTAGTAAGGT
GGCCAAATGGGTTCTGCAACTCGCTTTTGCTTGTGGAGTACTTTTCCGTGCAAAAGCGTACCAAACCGTCGTGAAAGAGGTGGATACGTAGAGGATCGTA
CGATGTCACCGCGACGTAAACTCGGAGGTCAAACTTGAGACCGTTGATTAGGAACGGATTGGCAACGTAGCGCTTCACAAGTTTGAGGCCATGAGGAAGG
GAATACGATAATGTCAGAAAATGGTGATTCCCACTGAATCTGAAAAGGAAAATAGGGAGACATACCTGTACAACGTACGCTTTCTTCTTCGAGAGTTTTG
GGGCTGCATGAGTACTCGCCGACACGAGTTTGATTCCCCTCCCACAAGACAAATTAGGCGGCTTGAGAATCCACACAACATTTACCTCAGCGTGAAAGCG
AGACAAGAACTGCTGCTTATCGTAGTCGTTCGCTGTGAGATACGTCTCCGGAATAATATCCGCATAGGCGGTCGGGTGTTTCTTTCTCATACGCAGTAGG
TGAGCACACAAGCGGTCCTTGCGACCTAGTTCGAAGCTGCCTGGAAAATGGTTTACACGCTGAAAAGGCAGCAATGCTCCAAATTCTTGTGCCTTGAGAT
GTTCACCCCAGAAAATATTCCAGGTATTGTTGAATGCTGTTTTGCGAACACTAGTTGCTCGTAGTGAGTTGGTGATGGCATTGTACAAGAATCGCTTCGT
AGCTGCAAAGGATACACGCAGCTCCGATTCATTTCCAGAAATCTCGCGGACTGCACGGAATCAAAATCAAGAGATGGTAAAGCGAAGTAAGAAGCTCGTC
TTTGAATAATCAGCCCAGATTGAGTCTTGCACCTTCATAGCCAGCAGGGCATGATCGCTCAAGTTGGACGGAGGCAGGATAAGGGAAGAAAAGAACTGGT
TGCGAGGACGGCTCGATTTTG