Description :
From Genome Similarity Track
Location :
contig_5:585035- 586756
Transcript NameFunction/comments
g1625.t1hypothetical protein

Sequence
1721 bases(100 bases per row)
GAAGAAGCAGATACGGAAGCGGAAACAGCAGTGCCGGCAACTGAAGGCGAGTAACCAGGCCAACGTTTTTCATTTCTTTCCCGTTCGAGGCAGCCGCCTA
CCGCCGTCTTGATTCGTGTGCTGCAACCATCTCATACAGAGCAGGTTGCGATATCGCAGGGTGTCGAAGAGATTTGCGTACGTGTCGAACGATTGGGGAG
TGGGGAAATCCGCTTGAAGTGTCCGCAGCGATGAAGCTCTTCCTCCATCTCTTTGATCAGCTGGAGGTCTTCGCCTTCGATCTGAGACAGCATTAAACTG
CTCGCGGATCCTTGTAGCAGTCCTTCAAATGTCCGTCGCCGCCGTTGTGCGTCCTTTTCCTTTTGGAGAATCGTCGGTGTGACCCCCGCGCCAATTGTCG
AGGTTGCTTGATTCCATGTAGTCGGTCTTGTTTGGCCTTATCGAGCTGCTGGGCCTCCCTTTGTGCGTCCACAAACGGGATTCCTACAAGCTGGAACAAG
TCGCTAACGAGGACAGTTTTGATGCGTTTGTCCATCGGCGACGAGCTGCTGAGAGACGGAAAAACATTGACCTCCAGTAGACGGGGCTTCATGCTCTCAC
CTTCGAGCAGCACATCGAATCCGTACAGCTCGAATCCATTGCGTCGACAACTACTGCCGCTGGAGGCCGACGCTAATTTATCTTCGACTGCAATCAGCGT
TTTGACGATCAAGTCTTCGAGTTCTTCCTGGAAACTCTCAAGCTCACGAGTTTTGCCTTCGTCGCAAAGGTATTTGAAGAGCATCTGGAGACTCCATTTG
CTACTGGAGAACGCATGAGCTTCGATATCATCTTGATTTTTTTGAAAAGCTGCAGCATTTTTTGTTGTTGATGCTGTAGTTAGTAAGGTGGCCAAATGGG
TTCTGCAACGCGCTTTTGCTTGTGGAGTACTTTTCCGTGCAAAAGCGTACCAAACCGTCGTGAAAGAGGTGGATACGTAGAGGATCGTACGATGTCACCG
CGACGTAAACTCGGAGGTCAAACTTGAGACCGTTGATTAGGAACGGATTGGCAACGTAGCGCTTCACAAGTTTGAGGCCATGAGGAAGGGAATACGATAA
TGTCAGAAAATGGTGATTCCCACTGAATCTGAAAAGGAAAATAGGGAGACATACCTGTACAACGTACGCTTTCTTCTTCGAGAGTTTTGGGGCTGCATGA
GTACTCGCCGACACGAGTTTGATTCCCCTCCCACAAGACAAATTAGGCGGCTTGAGAATCCACACAACATTTACCTCAGCGTGAAAGCGAGACAAGAACT
GCTGCTTATCGTAGTCGTTCGCTGTGAGATACGTCTCCGGAATAATATCCGCATAGGCGGTCGGGTGTTTCTTTCTCATACGCAGTAGGTGAGCACACAA
GCGGTCCTTGCGACCTAGTTCGAAGCTGCCTGGAAAATGGTTTACACGCTGAAAAGGCAGCAATGCACCAAATTCTTGTGCCTTGAGATGTTCACCCCAG
AAAATATTCCAGGTATTGTTGAATGCTGTTTTGCGAACACTAGTTGCTCGTAGTGAGTTGGTGATGGCATTGTACAAGAATCGCTTCGTAGCTGCAAAGG
ATACACGCAGCTCCGATTCATTTCCAGAAATCTCGCGGACTGCACGGAATCAAAATCAAGAGATGGTAAAGCGAAGTAAGAAGCTCGTCTTTGAATAATC
AGCCCAGATTGAGTCTTGCAC